Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AHCY cdna clone

AHCY cDNA Clone

Gene Names
AHCY; SAHH; adoHcyase
Synonyms
AHCY; AHCY cDNA Clone; AHCY cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgacaaactgccctacaaagtcgccgacatcggcctggctgcctggggacgcaaggccctggacattgctgagaacgagatgccgggcctgatgcgtatgcgggagcggtactcggcctccaagccactgaagggcgcccgcatcgctggctgcctgcacatgaccgtggagacggccgtcctcattgagaccctcgtcaccctgggtgctgaggtgcagtggtccagctgcaacatcttctccacccaggaccatgcggcggctgccattgccaaggctggcattccggtgtatgcctggaagggcgaaacggacgaggagtacctgtggtgcattgagcagaccctgtacttcaaggacgggcccctcaacatgattctggacgacgggggcgacctcaccaacctcatccacaccaagtacccgcagcttctgccaggcatccgaggcatctctgaggagaccacgactggggtccacaacctctacaagatgatggccaatgggatcctcaaggtgcctgccatcaatgtcaatgactccgtcaccaagagcaagtttgacaacctctatggctgccgggagtccctcatagatggcatcaagcgggccacagatgtgatgattgccggcaaggtagcggtggtagcaggctatggtgatgtgggcaagggctgtgcccaggccctgcggggtttcggagcccgcgtcatcatcaccgagattgaccccatcaacgcactgcaggctgccatggagggctatgaggtgaccaccatggatgaggcctgtcaggagggcaacatctttgtcaccaccacaggctgtattgacatcatccttggccggcactttgagcagatgaaggatgatgccattgtgtgtaacattggacactttgacgtggagatcgatgtcaagtggctcaacgagaacgccgtggagaaggtgaacatcaagccgcaggtggaccggtatcggttgaagaatgggcgccgcatcatcctgctggccgagggtcggctggtcaacctgggttgtgccatgggccaccccagcttcgtgatgagtaactccttcaccaaccaggtgatggcgcagatcgagctgtggacccatccagacaagtaccccgttggggttcatttcctgcccaagaagctggatgaggcagtggctgaagcccacctgggcaagctgaatgtgaagttgaccaagctaactgagaagcaagcccagtacctgggcatgtcctgtgatggccccttcaagccggatcactaccgctactga
Sequence Length
1299
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
191
Molecular Weight
44,659 Da
NCBI Official Full Name
Homo sapiens S-adenosylhomocysteine hydrolase, mRNA
NCBI Official Synonym Full Names
adenosylhomocysteinase
NCBI Official Symbol
AHCY
NCBI Official Synonym Symbols
SAHH; adoHcyase
NCBI Protein Information
adenosylhomocysteinase
UniProt Protein Name
Adenosylhomocysteinase
Protein Family
UniProt Gene Name
AHCY
UniProt Synonym Gene Names
SAHH; AdoHcyase
UniProt Entry Name
SAHH_HUMAN

NCBI Description

S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]

Uniprot Description

SAHH: Adenosylhomocysteine is a competitive inhibitor of S- adenosyl-L-methionine-dependent methyl transferase reactions; therefore adenosylhomocysteinase may play a key role in the control of methylations via regulation of the intracellular concentration of adenosylhomocysteine. Defects in AHCY are the cause of hypermethioninemia with S-adenosylhomocysteine hydrolase deficiency (HMAHCHD). A metabolic disorder characterized by hypermethioninemia associated with failure to thrive, mental and motor retardation, facial dysmorphism with abnormal hair and teeth, and myocardiopathy. Belongs to the adenosylhomocysteinase family.

Protein type: Amino Acid Metabolism - cysteine and methionine; Hydrolase; EC 3.3.1.1; Other Amino Acids Metabolism - selenoamino acid

Chromosomal Location of Human Ortholog: 20q11.22

Cellular Component: cytoplasm; cytosol

Molecular Function: adenosylhomocysteinase activity; protein binding

Biological Process: methylation; S-adenosylmethionine cycle; sulfur amino acid metabolic process

Disease: Hypermethioninemia With S-adenosylhomocysteine Hydrolase Deficiency

Research Articles on AHCY

Similar Products

Product Notes

The AHCY ahcy (Catalog #AAA1273471) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgaca aactgcccta caaagtcgcc gacatcggcc tggctgcctg gggacgcaag gccctggaca ttgctgagaa cgagatgccg ggcctgatgc gtatgcggga gcggtactcg gcctccaagc cactgaaggg cgcccgcatc gctggctgcc tgcacatgac cgtggagacg gccgtcctca ttgagaccct cgtcaccctg ggtgctgagg tgcagtggtc cagctgcaac atcttctcca cccaggacca tgcggcggct gccattgcca aggctggcat tccggtgtat gcctggaagg gcgaaacgga cgaggagtac ctgtggtgca ttgagcagac cctgtacttc aaggacgggc ccctcaacat gattctggac gacgggggcg acctcaccaa cctcatccac accaagtacc cgcagcttct gccaggcatc cgaggcatct ctgaggagac cacgactggg gtccacaacc tctacaagat gatggccaat gggatcctca aggtgcctgc catcaatgtc aatgactccg tcaccaagag caagtttgac aacctctatg gctgccggga gtccctcata gatggcatca agcgggccac agatgtgatg attgccggca aggtagcggt ggtagcaggc tatggtgatg tgggcaaggg ctgtgcccag gccctgcggg gtttcggagc ccgcgtcatc atcaccgaga ttgaccccat caacgcactg caggctgcca tggagggcta tgaggtgacc accatggatg aggcctgtca ggagggcaac atctttgtca ccaccacagg ctgtattgac atcatccttg gccggcactt tgagcagatg aaggatgatg ccattgtgtg taacattgga cactttgacg tggagatcga tgtcaagtgg ctcaacgaga acgccgtgga gaaggtgaac atcaagccgc aggtggaccg gtatcggttg aagaatgggc gccgcatcat cctgctggcc gagggtcggc tggtcaacct gggttgtgcc atgggccacc ccagcttcgt gatgagtaac tccttcacca accaggtgat ggcgcagatc gagctgtgga cccatccaga caagtacccc gttggggttc atttcctgcc caagaagctg gatgaggcag tggctgaagc ccacctgggc aagctgaatg tgaagttgac caagctaact gagaagcaag cccagtacct gggcatgtcc tgtgatggcc ccttcaagcc ggatcactac cgctactga. It is sometimes possible for the material contained within the vial of "AHCY, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.