Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AKR1B10 cdna clone

AKR1B10 cDNA Clone

Gene Names
AKR1B10; HIS; HSI; ARL1; ARL-1; ALDRLn; AKR1B11; AKR1B12
Synonyms
AKR1B10; AKR1B10 cDNA Clone; AKR1B10 cdna clone
Ordering
For Research Use Only!
Sequence
atggccacgtttgtggagctcagtaccaaagccaagatgcccattgtgggcctgggcacttggaagtctcctcttggcaaagtgaaagaagcagtgaaggtggccattgatgcaggatatcggcacattgactgtgcctatgtctatcagaatgaacatgaagtgggggaagccatccaagagaagatccaagagaaggctgtgaagcgggaggacctgttcatcgtcagcaagttgtggcccactttctttgagagaccccttgtgaggaaagcctttgagaagaccctcaaggacctgaagctgagctatctggacgtctatcttattcactggccacagggattcaagtctggggatgaccttttccccaaagatgataaaggtaatgccatcggtggaaaagcaacgttcttggatgcctgggaggccatggaggagctggtggatgaggggctggtgaaagcccttggggtctccaatttcagccacttccagatcgagaagctcttgaacaaacctggactgaaatataaaccagtgactaaccaggttgagtgtcacccatacctcacacaggagaaactgatccagtactgccactccaagggcatcaccgttacggcctacagccccctgggctctccggatagaccttgggccaagccagaagacccttccctgctggaggatcccaagattaaggagattgctgcaaagcacaaaaaaaccgcagcccaggttctgatccgtttccatatccagaggaatgtgattgtcatccccaagtctgtgacaccagcacgcattgttgagaacattcaggtctttgactttaaattgagtgatgaggagatggcaaccatactcagcttcaacagaaactggagggcctgtaacgtgttgcaatcctctcatttggaagactatcccttcgatgcagaatattga
Sequence Length
951
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,020 Da
NCBI Official Full Name
Homo sapiens aldo-keto reductase family 1, member B10 (aldose reductase), mRNA
NCBI Official Synonym Full Names
aldo-keto reductase family 1 member B10
NCBI Official Symbol
AKR1B10
NCBI Official Synonym Symbols
HIS; HSI; ARL1; ARL-1; ALDRLn; AKR1B11; AKR1B12
NCBI Protein Information
aldo-keto reductase family 1 member B10
UniProt Protein Name
Aldo-keto reductase family 1 member B10
UniProt Gene Name
AKR1B10
UniProt Synonym Gene Names
AKR1B11; ARP; hARP; SI reductase
UniProt Entry Name
AK1BA_HUMAN

NCBI Description

This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member can efficiently reduce aliphatic and aromatic aldehydes, and it is less active on hexoses. It is highly expressed in adrenal gland, small intestine, and colon, and may play an important role in liver carcinogenesis. [provided by RefSeq, Jul 2008]

Uniprot Description

AKR1B10: Acts as all-trans-retinaldehyde reductase. Can efficiently reduce aliphatic and aromatic aldehydes, and is less active on hexoses (in vitro). May be responsible for detoxification of reactive aldehydes in the digested food before the nutrients are passed on to other organs. Belongs to the aldo/keto reductase family.

Protein type: EC 1.1.1.-; Carbohydrate Metabolism - fructose and mannose; EC 1.1.1.21; Lipid Metabolism - linoleic acid; Carbohydrate Metabolism - butanoate; Oxidoreductase

Chromosomal Location of Human Ortholog: 7q33

Cellular Component: cytosol

Molecular Function: aldo-keto reductase activity; geranylgeranyl reductase activity; indanol dehydrogenase activity; protein binding; retinal dehydrogenase activity

Biological Process: aldehyde metabolic process; digestion; farnesol catabolic process; retinoid metabolic process; steroid metabolic process

Research Articles on AKR1B10

Similar Products

Product Notes

The AKR1B10 akr1b10 (Catalog #AAA1273450) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccacgt ttgtggagct cagtaccaaa gccaagatgc ccattgtggg cctgggcact tggaagtctc ctcttggcaa agtgaaagaa gcagtgaagg tggccattga tgcaggatat cggcacattg actgtgccta tgtctatcag aatgaacatg aagtggggga agccatccaa gagaagatcc aagagaaggc tgtgaagcgg gaggacctgt tcatcgtcag caagttgtgg cccactttct ttgagagacc ccttgtgagg aaagcctttg agaagaccct caaggacctg aagctgagct atctggacgt ctatcttatt cactggccac agggattcaa gtctggggat gaccttttcc ccaaagatga taaaggtaat gccatcggtg gaaaagcaac gttcttggat gcctgggagg ccatggagga gctggtggat gaggggctgg tgaaagccct tggggtctcc aatttcagcc acttccagat cgagaagctc ttgaacaaac ctggactgaa atataaacca gtgactaacc aggttgagtg tcacccatac ctcacacagg agaaactgat ccagtactgc cactccaagg gcatcaccgt tacggcctac agccccctgg gctctccgga tagaccttgg gccaagccag aagacccttc cctgctggag gatcccaaga ttaaggagat tgctgcaaag cacaaaaaaa ccgcagccca ggttctgatc cgtttccata tccagaggaa tgtgattgtc atccccaagt ctgtgacacc agcacgcatt gttgagaaca ttcaggtctt tgactttaaa ttgagtgatg aggagatggc aaccatactc agcttcaaca gaaactggag ggcctgtaac gtgttgcaat cctctcattt ggaagactat cccttcgatg cagaatattg a. It is sometimes possible for the material contained within the vial of "AKR1B10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.