Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSPB1 cdna clone

HSPB1 cDNA Clone

Gene Names
HSPB1; CMT2F; HMN2B; HSP27; HSP28; Hsp25; SRP27; HS.76067; HEL-S-102
Synonyms
HSPB1; HSPB1 cDNA Clone; HSPB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccgagcgccgcgtccccttctcgctcctgcggggccccagctgggaccccttccgcgactggtacccgcatagccgcctcttcgaccaggccttcgggctgccccggctgccggaggagtggtcgcagtggttaggcggcagcagctggccaggctacgtgcgccccctgccccccgccgccatcgagagccccgcagtggccgcgcccgcctacagccgcgcgctcagccggcaactcagcagcggggtctcggagatccggcacactgcggaccgctggcgcgtgtccctggatgtcaaccacttcgccccggacgagcggacggtcaagaccaaggatggcgtggtggagatctccggcaagcacgaggagttgcaggacgagcatggctacatctcccggtgcttcacgcggaaatacacgctgccccccggtgtggaccccacccaagtttcctcctccctgtcccctgagggcacactgaccgtggaggcccccatgcccaagctagccacgcagtccaacgagatcaccatcccagtcaccttcgagtcgcgggcccagcttgggggcccagaagctgcaaaatccgatgagactgccgccaagtaa
Sequence Length
618
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,783 Da
NCBI Official Full Name
Homo sapiens heat shock 27kDa protein 1, mRNA
NCBI Official Synonym Full Names
heat shock protein family B (small) member 1
NCBI Official Symbol
HSPB1
NCBI Official Synonym Symbols
CMT2F; HMN2B; HSP27; HSP28; Hsp25; SRP27; HS.76067; HEL-S-102
NCBI Protein Information
heat shock protein beta-1
UniProt Protein Name
Heat shock protein beta-1
Protein Family
UniProt Gene Name
HSPB1
UniProt Synonym Gene Names
HSP27; HSP28; HspB1; HSP 27; SRP27
UniProt Entry Name
HSPB1_HUMAN

NCBI Description

The protein encoded by this gene is induced by environmental stress and developmental changes. The encoded protein is involved in stress resistance and actin organization and translocates from the cytoplasm to the nucleus upon stress induction. Defects in this gene are a cause of Charcot-Marie-Tooth disease type 2F (CMT2F) and distal hereditary motor neuropathy (dHMN). [provided by RefSeq, Oct 2008]

Uniprot Description

HSP27: a small heat shock protein that is regulated both transcriptionally and posttranslationally. Modulates actin polymerization and reorganization. Its expression level increases several-fold in response to stress and is phosphorylated by MAPKAP kinase 2. Cytoplasmic in interphase cells. Colocalizes with mitotic spindles in mitotic cells. Translocates to the nucleus during heat shock.

Protein type: Motility/polarity/chemotaxis; Heat shock protein; Chaperone

Chromosomal Location of Human Ortholog: 7q11.23

Cellular Component: cytoplasm; cytoskeleton; cytosol; extracellular matrix; extracellular space; focal adhesion; nucleus; proteasome complex

Molecular Function: identical protein binding; protein binding; protein kinase binding; protein kinase C binding; protein kinase C inhibitor activity; ubiquitin binding

Biological Process: cell motility; negative regulation of apoptosis; negative regulation of protein kinase activity; positive regulation of angiogenesis; positive regulation of blood vessel endothelial cell migration; positive regulation of interleukin-1 beta production; positive regulation of tumor necrosis factor biosynthetic process; regulation of I-kappaB kinase/NF-kappaB cascade; regulation of mRNA stability; regulation of translational initiation; response to virus; retinal homeostasis; vascular endothelial growth factor receptor signaling pathway

Disease: Charcot-marie-tooth Disease, Axonal, Type 2f; Neuronopathy, Distal Hereditary Motor, Type Iib

Research Articles on HSPB1

Similar Products

Product Notes

The HSPB1 hspb1 (Catalog #AAA1273435) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccgagc gccgcgtccc cttctcgctc ctgcggggcc ccagctggga ccccttccgc gactggtacc cgcatagccg cctcttcgac caggccttcg ggctgccccg gctgccggag gagtggtcgc agtggttagg cggcagcagc tggccaggct acgtgcgccc cctgcccccc gccgccatcg agagccccgc agtggccgcg cccgcctaca gccgcgcgct cagccggcaa ctcagcagcg gggtctcgga gatccggcac actgcggacc gctggcgcgt gtccctggat gtcaaccact tcgccccgga cgagcggacg gtcaagacca aggatggcgt ggtggagatc tccggcaagc acgaggagtt gcaggacgag catggctaca tctcccggtg cttcacgcgg aaatacacgc tgccccccgg tgtggacccc acccaagttt cctcctccct gtcccctgag ggcacactga ccgtggaggc ccccatgccc aagctagcca cgcagtccaa cgagatcacc atcccagtca ccttcgagtc gcgggcccag cttgggggcc cagaagctgc aaaatccgat gagactgccg ccaagtaa. It is sometimes possible for the material contained within the vial of "HSPB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.