Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NECAB2 cdna clone

NECAB2 cDNA Clone

Gene Names
NECAB2; EFCBP2; stip-2
Synonyms
NECAB2; NECAB2 cDNA Clone; NECAB2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggttataccaagaaggtatatgagggtgggagcaacgtggaccagtttgtgacccgcttcctcctgaaggagacggccaatcagatccagtcgctgctgagctcagtggagagtgcggtggaggccatcgaggaacagaccagccagctccgacagaaccacatcaaacccagccacagcgcggcacagacctggtgtggaagccccactcccgcctctgcccccaaccacaagctcatggctatggaacaaggcaagacccttccatctgccacggaggatgcaaaggaagagggtctggaagcccagatcagccgcttggcagagctgattgggaggctggagagcaaagcactgtggttcgacctgcagcagcgcctgtcagatgaagatggcaccaacatgcacctgcagctggtccggcaggagatggccgtgtgccccgagcaactgagcgagtttctggactctctgcgccagtatctgcgggggaccactggcgtgaggaactgcttccacatcactgccgtgaggctctcagatggcttcacctttgtcatctatgagttctgggagacagaggaggcgtggaagaggcacctgcagagccccctgtgtaaggcgttccggcacgtcaaggtggacacactgagccagcctgaggccctctccaggatcttggtgccagctgcttggtgcacggtgggacgggactga
Sequence Length
720
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,194 Da
NCBI Official Full Name
Homo sapiens EF-hand calcium binding protein 2, mRNA
NCBI Official Synonym Full Names
N-terminal EF-hand calcium binding protein 2
NCBI Official Symbol
NECAB2
NCBI Official Synonym Symbols
EFCBP2; stip-2
NCBI Protein Information
N-terminal EF-hand calcium-binding protein 2
UniProt Protein Name
N-terminal EF-hand calcium-binding protein 2
UniProt Gene Name
NECAB2
UniProt Synonym Gene Names
EFCBP2; EF-hand calcium-binding protein 2; Stip-2
UniProt Entry Name
NECA2_HUMAN

NCBI Description

The protein encoded by this gene is a neuronal calcium-binding protein that binds to and modulates the function of at least two receptors, adenosine A(2A) receptor and metabotropic glutamate receptor type 5. [provided by RefSeq, Jul 2016]

Uniprot Description

EFCBP2:

Chromosomal Location of Human Ortholog: 16q23.3

Molecular Function: protein binding

Research Articles on NECAB2

Similar Products

Product Notes

The NECAB2 necab2 (Catalog #AAA1273344) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggttata ccaagaaggt atatgagggt gggagcaacg tggaccagtt tgtgacccgc ttcctcctga aggagacggc caatcagatc cagtcgctgc tgagctcagt ggagagtgcg gtggaggcca tcgaggaaca gaccagccag ctccgacaga accacatcaa acccagccac agcgcggcac agacctggtg tggaagcccc actcccgcct ctgcccccaa ccacaagctc atggctatgg aacaaggcaa gacccttcca tctgccacgg aggatgcaaa ggaagagggt ctggaagccc agatcagccg cttggcagag ctgattggga ggctggagag caaagcactg tggttcgacc tgcagcagcg cctgtcagat gaagatggca ccaacatgca cctgcagctg gtccggcagg agatggccgt gtgccccgag caactgagcg agtttctgga ctctctgcgc cagtatctgc gggggaccac tggcgtgagg aactgcttcc acatcactgc cgtgaggctc tcagatggct tcacctttgt catctatgag ttctgggaga cagaggaggc gtggaagagg cacctgcaga gccccctgtg taaggcgttc cggcacgtca aggtggacac actgagccag cctgaggccc tctccaggat cttggtgcca gctgcttggt gcacggtggg acgggactga. It is sometimes possible for the material contained within the vial of "NECAB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.