Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF416 cdna clone

ZNF416 cDNA Clone

Synonyms
ZNF416; ZNF416 cDNA Clone; ZNF416 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggccgtgcttagggattcgacttcggttcccgtgactgcagaagctaaacttatgggctttacacagggctgtgtgacctttgaggacgtggccatttacttctcccaggaagaatgggggctccttgatgaggctcagaggctcctgtaccgcgatgtgatgctggagaactttgcacttataactgcgctggtttgttggcatgggatggaggatgaagagacacctgagcaaagtgtttctgtagaaggagtacctcaggtcaggactccagaggccagtccatccacccagaagattcaatcctgtgacatgtgtgtcccattcctgaccgacattttgcacctgaccgatttgcctgggcaggaactatacttgactggggcatgtgcggtctttcaccaggaccagaagcatcatagtgcagagaaacccttggaaagtgacatggacaaggcctcatttgtgcagtgctgcctgttccatgagtcaggaatgcctttcaccagcagtgaggttgggaaggacttcctagccccattgggcattcttcagccgcaagctattgctaactatgagaagccaaacaaaatcagcaaatgtgaggaggcctttcatgttggaataagtcattacaagtggagtcaatgcaggagagagtccagccacaaacacactttttttcaccctagagtctgcactggaaaaaggctttatgaatctagcaaatgtgggaaagcctgctgctgtgagtgctcccttgttcagctgcaaagagtccaccctggagaaaggccttatgagtgcagtgaatgtgggaaatcttttagccaaacctctcatctgaatgatcatcggagaatccacactggagaaaggccttatgtgtgtggtcagtgtgggaaatcatttagccaaagagccaccctcattaaacatcacagagttcacactggagaaaggccttacgagtgtggtgaatgtgggaaatcttttagccaaagttccaaccttattgaacattgcagaattcacactggagaaaggccttatgagtgtgatgaatgtggaaaagcctttgggtccaaatccactcttgttcgacaccagagaactcacacaggagaaaagccatatgagtgtggtgaatgtgggaaattattcagacaaagcttcagccttgttgtacaccagagaattcacactacagcaaggccttatgagtgtggccagtgtgggaaatcatttagcctaaagtgtggcctcattcagcaccagttaattcacagtggagctaggccctttgagtgtgatgagtgcggaaaatcctttagccaaagaaccaccctcaataaacaccacaaagttcacactgcagaaaggccttatgtatgtggggaatgtgggaaagcttttatgttcaaatctaaacttgttaggcaccagagaactcacactggagaaaggccttttgagtgcagtgaatgtgggaaattttttagacaaagctataccctcgttgaacaccagaaaattcacactggattaaggccttacgactgtggacagtgcgggaaatcctttatccaaaagtctagcctcattcaacaccaagtggttcacacaggagaaaggccatatgagtgtggcaaatgtgggaagtcctttacacaacactctggcctcattctccaccgaaaatctcacactgtggagaggcctcgtgacagcagcaaatgtggaaaaccctacagcccaagatctaacattgtttaa
Sequence Length
1785
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,188 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 416, mRNA
NCBI Official Synonym Full Names
zinc finger protein 416
NCBI Official Symbol
ZNF416
NCBI Protein Information
zinc finger protein 416
UniProt Protein Name
Zinc finger protein 416
Protein Family
UniProt Gene Name
ZNF416
UniProt Entry Name
ZN416_HUMAN

Uniprot Description

ZNF416: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 19q13.4

Similar Products

Product Notes

The ZNF416 znf416 (Catalog #AAA1273341) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg ccgtgcttag ggattcgact tcggttcccg tgactgcaga agctaaactt atgggcttta cacagggctg tgtgaccttt gaggacgtgg ccatttactt ctcccaggaa gaatgggggc tccttgatga ggctcagagg ctcctgtacc gcgatgtgat gctggagaac tttgcactta taactgcgct ggtttgttgg catgggatgg aggatgaaga gacacctgag caaagtgttt ctgtagaagg agtacctcag gtcaggactc cagaggccag tccatccacc cagaagattc aatcctgtga catgtgtgtc ccattcctga ccgacatttt gcacctgacc gatttgcctg ggcaggaact atacttgact ggggcatgtg cggtctttca ccaggaccag aagcatcata gtgcagagaa acccttggaa agtgacatgg acaaggcctc atttgtgcag tgctgcctgt tccatgagtc aggaatgcct ttcaccagca gtgaggttgg gaaggacttc ctagccccat tgggcattct tcagccgcaa gctattgcta actatgagaa gccaaacaaa atcagcaaat gtgaggaggc ctttcatgtt ggaataagtc attacaagtg gagtcaatgc aggagagagt ccagccacaa acacactttt tttcacccta gagtctgcac tggaaaaagg ctttatgaat ctagcaaatg tgggaaagcc tgctgctgtg agtgctccct tgttcagctg caaagagtcc accctggaga aaggccttat gagtgcagtg aatgtgggaa atcttttagc caaacctctc atctgaatga tcatcggaga atccacactg gagaaaggcc ttatgtgtgt ggtcagtgtg ggaaatcatt tagccaaaga gccaccctca ttaaacatca cagagttcac actggagaaa ggccttacga gtgtggtgaa tgtgggaaat cttttagcca aagttccaac cttattgaac attgcagaat tcacactgga gaaaggcctt atgagtgtga tgaatgtgga aaagcctttg ggtccaaatc cactcttgtt cgacaccaga gaactcacac aggagaaaag ccatatgagt gtggtgaatg tgggaaatta ttcagacaaa gcttcagcct tgttgtacac cagagaattc acactacagc aaggccttat gagtgtggcc agtgtgggaa atcatttagc ctaaagtgtg gcctcattca gcaccagtta attcacagtg gagctaggcc ctttgagtgt gatgagtgcg gaaaatcctt tagccaaaga accaccctca ataaacacca caaagttcac actgcagaaa ggccttatgt atgtggggaa tgtgggaaag cttttatgtt caaatctaaa cttgttaggc accagagaac tcacactgga gaaaggcctt ttgagtgcag tgaatgtggg aaatttttta gacaaagcta taccctcgtt gaacaccaga aaattcacac tggattaagg ccttacgact gtggacagtg cgggaaatcc tttatccaaa agtctagcct cattcaacac caagtggttc acacaggaga aaggccatat gagtgtggca aatgtgggaa gtcctttaca caacactctg gcctcattct ccaccgaaaa tctcacactg tggagaggcc tcgtgacagc agcaaatgtg gaaaacccta cagcccaaga tctaacattg tttaa. It is sometimes possible for the material contained within the vial of "ZNF416, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.