RHOT2 cdna clone
RHOT2 cDNA Clone
Gene Names
RHOT2; RASL; ARHT2; MIRO2; MIRO-2; C16orf39
Synonyms
RHOT2; RHOT2 cDNA Clone; RHOT2 cdna clone
Sequence
atgaggcgggacgtgcgcatcctgttactgggcgaggcccaggtggggaagacgtcgctgatcctgtccctggtgggcgaggagttccccgaggaggtccctccccgcgcggaggagatcacgatccccgcggacgtcaccccggagaaggtgcccacccacatcgtggactactcagaagccgagcagacggacgaggagctgcgggaggagatccacaaggcaaacgtggtgtgtgtggtgtatgacgtctctgaggaggccaccattgagaagattcgaactaagtggatcccactggtgaatggggggaccacgcaggggcccagggtgcccatcatcctagtgggcaacaagtcagacctgcggtcggggagctccatggaggccgtgctccccatcatgagccagtttcccgagattgagacctgcgtggagtgttcggccaagaacctgaggaacatctcagagctgttctactacgcccagaaggccgtcctgcatcccacagcccccctctatgaccctgaggccaagcagttgaggcccgcgtgcgcccaggcgctgacgcgcatcttcaggctctcagatcaggacctggaccaggcgctcagtgacgaagagctcaacgctttccagaaatcctgctttgggcaccccctggccccgcaggccctggaggacgtgaagacggtggtgtgcaggaacgtggcgggcggcgtgcgggaggaccggctgaccctggatggtttcctcttcctgaacacgctcttcatccagcgcggccggcacgagaccacctggaccatcctgcggcgcttcggctacagcgatgccctggagctgactgcggactatctctcccctctgatccacgtgccccccggctgcagcacggagctcaaccaccttggctaccagtttgtgcagagagtgtttgagaagcacgaccaggaccgcgacggcgccctctcgcccgtggagctgcaaagccttttcagtgtgttcccagcagcgccctggggccccgagctcccacgcacagtccgcacagaggccggccggttgcccctgcacggatacctctgccagtggaccctggtgacctacctggacgtccggagctgccttggacacctaggctacctgggctaccccaccctctgtgagcaggaccaggcccatgccatcacagtcactcgtgagaagaggctggaccaggagaagggacagacgcagcggagcgtcctcctgtgcaaggtggtaggggcccgtggagtgggcaagtctgccttcctgcaggcttttctcggccgcggcctggggcaccaggacacgagggagcagcctcccggctacgccatcgacacggtgcaggtcaatggacaggagaagtacttgatcctctgtgaggtgggcacagatggtctgctggccacatcgctggacgccacctgtgacgttgcctgcttgatgtttgatggcagtgacccaaagtcctttgcacattgtgccagcgtctacaagcaccattacatggacgggcagaccccctgcctctttgtctcctccaaggccgacctgcccgaaggtgtcgcggtgtctggcccatcaccggccgagttttgccgcaagcaccggctacccgctcccgtgccgttctcctgtgctggcccagccgagcccagcaccaccatcttcacccagctcgccaccatggccgccttcccacatttggtccacgcagagctgcatccctcttccttctggctccgggggctgctgggggttgtcggggccgccgtggccgcagtcctcagcttctcactctacagggtcctggtgaagagccagtga
Sequence Length
1857
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,077 Da
NCBI Official Full Name
Homo sapiens ras homolog gene family, member T2, mRNA
NCBI Official Synonym Full Names
ras homolog family member T2
NCBI Official Symbol
RHOT2
NCBI Official Synonym Symbols
RASL; ARHT2; MIRO2; MIRO-2; C16orf39
NCBI Protein Information
mitochondrial Rho GTPase 2
UniProt Protein Name
Mitochondrial Rho GTPase 2
UniProt Gene Name
RHOT2
UniProt Synonym Gene Names
ARHT2; C16orf39; MIRO-2; hMiro-2
UniProt Entry Name
MIRO2_HUMAN
NCBI Description
This gene encodes a member of the Rho family of GTPases. The encoded protein is localized to the outer mitochondrial membrane and plays a role in mitochondrial trafficking and fusion-fission dynamics. [provided by RefSeq, Nov 2011]
Uniprot Description
RHOT2: Mitochondrial GTPase involved in mitochondrial trafficking. Probably involved in control of anterograde transport of mitochondria and their subcellular distribution. Belongs to the mitochondrial Rho GTPase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: G protein, monomeric, Rho; G protein; Hydrolase; G protein, monomeric; Membrane protein, integral; EC 3.6.5.-; Mitochondrial
Chromosomal Location of Human Ortholog: 16p13.3
Cellular Component: cytosol; integral to mitochondrial outer membrane; membrane; plasma membrane
Molecular Function: protein binding
Biological Process: cellular homeostasis; mitochondrion transport along microtubule; regulation of small GTPase mediated signal transduction
Research Articles on RHOT2
Similar Products
Product Notes
The RHOT2 rhot2 (Catalog #AAA1273247) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggcggg acgtgcgcat cctgttactg ggcgaggccc aggtggggaa gacgtcgctg atcctgtccc tggtgggcga ggagttcccc gaggaggtcc ctccccgcgc ggaggagatc acgatccccg cggacgtcac cccggagaag gtgcccaccc acatcgtgga ctactcagaa gccgagcaga cggacgagga gctgcgggag gagatccaca aggcaaacgt ggtgtgtgtg gtgtatgacg tctctgagga ggccaccatt gagaagattc gaactaagtg gatcccactg gtgaatgggg ggaccacgca ggggcccagg gtgcccatca tcctagtggg caacaagtca gacctgcggt cggggagctc catggaggcc gtgctcccca tcatgagcca gtttcccgag attgagacct gcgtggagtg ttcggccaag aacctgagga acatctcaga gctgttctac tacgcccaga aggccgtcct gcatcccaca gcccccctct atgaccctga ggccaagcag ttgaggcccg cgtgcgccca ggcgctgacg cgcatcttca ggctctcaga tcaggacctg gaccaggcgc tcagtgacga agagctcaac gctttccaga aatcctgctt tgggcacccc ctggccccgc aggccctgga ggacgtgaag acggtggtgt gcaggaacgt ggcgggcggc gtgcgggagg accggctgac cctggatggt ttcctcttcc tgaacacgct cttcatccag cgcggccggc acgagaccac ctggaccatc ctgcggcgct tcggctacag cgatgccctg gagctgactg cggactatct ctcccctctg atccacgtgc cccccggctg cagcacggag ctcaaccacc ttggctacca gtttgtgcag agagtgtttg agaagcacga ccaggaccgc gacggcgccc tctcgcccgt ggagctgcaa agccttttca gtgtgttccc agcagcgccc tggggccccg agctcccacg cacagtccgc acagaggccg gccggttgcc cctgcacgga tacctctgcc agtggaccct ggtgacctac ctggacgtcc ggagctgcct tggacaccta ggctacctgg gctaccccac cctctgtgag caggaccagg cccatgccat cacagtcact cgtgagaaga ggctggacca ggagaaggga cagacgcagc ggagcgtcct cctgtgcaag gtggtagggg cccgtggagt gggcaagtct gccttcctgc aggcttttct cggccgcggc ctggggcacc aggacacgag ggagcagcct cccggctacg ccatcgacac ggtgcaggtc aatggacagg agaagtactt gatcctctgt gaggtgggca cagatggtct gctggccaca tcgctggacg ccacctgtga cgttgcctgc ttgatgtttg atggcagtga cccaaagtcc tttgcacatt gtgccagcgt ctacaagcac cattacatgg acgggcagac cccctgcctc tttgtctcct ccaaggccga cctgcccgaa ggtgtcgcgg tgtctggccc atcaccggcc gagttttgcc gcaagcaccg gctacccgct cccgtgccgt tctcctgtgc tggcccagcc gagcccagca ccaccatctt cacccagctc gccaccatgg ccgccttccc acatttggtc cacgcagagc tgcatccctc ttccttctgg ctccgggggc tgctgggggt tgtcggggcc gccgtggccg cagtcctcag cttctcactc tacagggtcc tggtgaagag ccagtga. It is sometimes possible for the material contained within the vial of "RHOT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
