Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBBP5 cdna clone

RBBP5 cDNA Clone

Gene Names
RBBP5; RBQ3; SWD1
Synonyms
RBBP5; RBBP5 cDNA Clone; RBBP5 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacctcgagttgctggagtcctttgggcagaactatccagaggaagctgatggaactttggattgtatcagcatggctttgacttgcacctttaacaggtggggcacactgcttgcagttggctgtaatgatggccgaattgtcatctgggatttcttgacaagaggcattgctaaaataattagtgcacacatccatccagtgtgttctttatgctggagccgagatggtcataaactcgtgagtgcttccactgataacatagtgtcacagtgggatgttctttcaggcgactgtgaccagaggtttcgattcccttcacccatcttaaaagtccaatatcatccacgagatcagaacaaggttctcgtgtgtcccatgaaatctgctcctgtcatgttgaccctttcagattccaaacatgttgttctgccagtggacgatgactccgatttgaacgttgtggcatcttttgataggcgaggggaatatatttatacgggaaacgcaaaaggcaagattttggtcctaaaaacagattctcaggatcttgttgcttccttcagagtgacaactggaacaagcaataccacagccattaagtcaattgagtttgcccggaaggggagttgctttttaattaacacggcagatcgaataatcagagtttatgatggcagagaaatcttaacatgtggaagagatggagagcctgaacctatgcagaaattgcaggatttggtgaataggaccccatggaagaaatgttgtttctctggggatggggaatacatcgtggcaggttctgcccggcagcatgccctgtacatctgggagaagagcattggcaacctggtgaagattctccatgggacgagaggagaactcctcttggatgtagcttggcatcctgttcgacccatcatagcatccatttccagtggagtggtatctatctgggcacagaatcaagtagaaaactggagtgcatttgcaccagacttcaaagaattggatgaaaatgtagaatacgaagaaagggaatcagagtttgatattgaagatgaagataagagtgagcctgagcagacaggggctgatgctgcagaagatgaggaagtggatgtcaccagcgtggaccctattgctgccttctgtagcagtgatgaagagctggaagattcaaaggctctattgtatttacccattgcccctgaggtagaagacccagaagaaaatccttacggccccccaccggatgcagtccaaacctccttgatggatgaaggggctagttcagagaagaagaggcagtcctcagcagatgggtcccagccacctaagaagaaacccaaaacaaccaatatagaacttcaaggagtaccaaatgatgaagtccatccactactgggtgtgaagggggatggcaaatccaagaagaagcaagcaggccggcctaaaggatcaaaaggtaaagagaaagattctccatttaaaccgaaactctacaaaggggacagaggtttacctctggaaggatcagcgaagggtaaagtgcaggcggaactcagccagcccttgacagcaggaggagcaatctcagaactgttatga
Sequence Length
1617
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,072 Da
NCBI Official Full Name
Homo sapiens retinoblastoma binding protein 5, mRNA
NCBI Official Synonym Full Names
RB binding protein 5, histone lysine methyltransferase complex subunit
NCBI Official Symbol
RBBP5
NCBI Official Synonym Symbols
RBQ3; SWD1
NCBI Protein Information
retinoblastoma-binding protein 5
UniProt Protein Name
Retinoblastoma-binding protein 5
UniProt Gene Name
RBBP5
UniProt Synonym Gene Names
RBQ3; RBBP-5
UniProt Entry Name
RBBP5_HUMAN

NCBI Description

This gene encodes a ubiquitously expressed nuclear protein which belongs to a highly conserved subfamily of WD-repeat proteins. The encoded protein binds directly to retinoblastoma protein, which regulates cell proliferation. It interacts preferentially with the underphosphorylated retinoblastoma protein via the E1A-binding pocket B. Three alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2010]

Uniprot Description

RBBP5: As part of the MLL1/MLL complex it is involved in methylation and dimethylation at 'Lys-4' of histone H3. H3 'Lys-4' methylation represents a specific tag for epigenetic transcriptional activation. Component of the SET1 complex, at least composed of the catalytic subunit (SETD1A or SETD1B), WDR5, WDR82, RBBP5, ASH2L/ASH2, CXXC1/CFP1, HCFC1 and DPY30. Core component of several methyltransferase-containing complexes including MLL1/MLL, ASCOM, MLL2/MLL3 and MLL3/MLL4. Each complex is at least composed of ASH2L, RBBP5, DPY30, WDR5, one or more specific histone methyltransferases (MLL, MLL2, MLL3 and MLL4), and the facultative components C16orf53/PA1, C17orf49, CHD8, E2F6, HCFC1, HCFC2, HSP70, INO80C, KDM6A, KANSL1, LAS1L, MAX, MCRS1, MEN1, MGA, MYST1/MOF, NCOA6, PAXIP1/PTIP, PELP1, PHF20, PRP31, RING2, RUVB1/TIP49A, RUVB2/TIP49B, SENP3, TAF1, TAF4, TAF6, TAF7, TAF9 and TEX10. Interacts with WDR5 and ASH2L; the interaction is direct. Interacts with WDR82 and SETD1A. Ubiquitously expressed. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 1q32

Cellular Component: histone methyltransferase complex; nucleolus; nucleoplasm; nucleus

Molecular Function: histone lysine N-methyltransferase activity (H3-K4 specific); histone-lysine N-methyltransferase activity; methylated histone residue binding; protein binding

Biological Process: histone H3-K4 methylation; response to DNA damage stimulus; response to estrogen stimulus

Research Articles on RBBP5

Similar Products

Product Notes

The RBBP5 rbbp5 (Catalog #AAA1273214) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacctcg agttgctgga gtcctttggg cagaactatc cagaggaagc tgatggaact ttggattgta tcagcatggc tttgacttgc acctttaaca ggtggggcac actgcttgca gttggctgta atgatggccg aattgtcatc tgggatttct tgacaagagg cattgctaaa ataattagtg cacacatcca tccagtgtgt tctttatgct ggagccgaga tggtcataaa ctcgtgagtg cttccactga taacatagtg tcacagtggg atgttctttc aggcgactgt gaccagaggt ttcgattccc ttcacccatc ttaaaagtcc aatatcatcc acgagatcag aacaaggttc tcgtgtgtcc catgaaatct gctcctgtca tgttgaccct ttcagattcc aaacatgttg ttctgccagt ggacgatgac tccgatttga acgttgtggc atcttttgat aggcgagggg aatatattta tacgggaaac gcaaaaggca agattttggt cctaaaaaca gattctcagg atcttgttgc ttccttcaga gtgacaactg gaacaagcaa taccacagcc attaagtcaa ttgagtttgc ccggaagggg agttgctttt taattaacac ggcagatcga ataatcagag tttatgatgg cagagaaatc ttaacatgtg gaagagatgg agagcctgaa cctatgcaga aattgcagga tttggtgaat aggaccccat ggaagaaatg ttgtttctct ggggatgggg aatacatcgt ggcaggttct gcccggcagc atgccctgta catctgggag aagagcattg gcaacctggt gaagattctc catgggacga gaggagaact cctcttggat gtagcttggc atcctgttcg acccatcata gcatccattt ccagtggagt ggtatctatc tgggcacaga atcaagtaga aaactggagt gcatttgcac cagacttcaa agaattggat gaaaatgtag aatacgaaga aagggaatca gagtttgata ttgaagatga agataagagt gagcctgagc agacaggggc tgatgctgca gaagatgagg aagtggatgt caccagcgtg gaccctattg ctgccttctg tagcagtgat gaagagctgg aagattcaaa ggctctattg tatttaccca ttgcccctga ggtagaagac ccagaagaaa atccttacgg ccccccaccg gatgcagtcc aaacctcctt gatggatgaa ggggctagtt cagagaagaa gaggcagtcc tcagcagatg ggtcccagcc acctaagaag aaacccaaaa caaccaatat agaacttcaa ggagtaccaa atgatgaagt ccatccacta ctgggtgtga agggggatgg caaatccaag aagaagcaag caggccggcc taaaggatca aaaggtaaag agaaagattc tccatttaaa ccgaaactct acaaagggga cagaggttta cctctggaag gatcagcgaa gggtaaagtg caggcggaac tcagccagcc cttgacagca ggaggagcaa tctcagaact gttatga. It is sometimes possible for the material contained within the vial of "RBBP5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.