Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2G2 cdna clone

UBE2G2 cDNA Clone

Gene Names
UBE2G2; UBC7
Synonyms
UBE2G2; UBE2G2 cDNA Clone; UBE2G2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggggaccgcgctcaagaggctgatggccgagtacaaacaattaacactgaatcctccggaaggaattgtagcaggccccatgaatgaagagaacttttttgaatgggaggcattgatcatgggcccagaagacacctgctttgagtttggtgtttttcctgccatcctgagtttcccacttgattacccgttaagtcccccaaagatgagatttacctgtgagatgtttcatcccaacatctaccctgatgggagagtctgcatttccatcctccacgcgccaggcgatgaccccatgggctacgagagcagcgcggagcggtggagtcctgtgcagagtgtggagaagatcctgctgtcggtggtgagcatgctggcagagcccaatgacgaaagtggagctaacgtggatgcgtccaaaatgtggcgcgatgaccgggagcagttctataagattgccaagcagatcgtccagaagtctctgggactgtga
Sequence Length
498
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,614 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast), mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 G2
NCBI Official Symbol
UBE2G2
NCBI Official Synonym Symbols
UBC7
NCBI Protein Information
ubiquitin-conjugating enzyme E2 G2
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 G2
UniProt Gene Name
UBE2G2
UniProt Entry Name
UB2G2_HUMAN

NCBI Description

The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse counterpart. This gene is ubiquitously expressed, with high expression seen in adult muscle. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]

Uniprot Description

UBE2G2: Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro catalyzes 'Lys- 48'-linked polyubiquitination. Involved in endoplasmic reticulum- associated degradation (ERAD). Belongs to the ubiquitin-conjugating enzyme family.

Protein type: EC 6.3.2.19; Ubiquitin conjugating system; Ubiquitin ligase; Ligase; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: cytosol

Molecular Function: protein binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: cellular protein catabolic process; ER-associated protein catabolic process; protein amino acid N-linked glycosylation via asparagine; ubiquitin-dependent protein catabolic process

Research Articles on UBE2G2

Similar Products

Product Notes

The UBE2G2 ube2g2 (Catalog #AAA1273208) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggga ccgcgctcaa gaggctgatg gccgagtaca aacaattaac actgaatcct ccggaaggaa ttgtagcagg ccccatgaat gaagagaact tttttgaatg ggaggcattg atcatgggcc cagaagacac ctgctttgag tttggtgttt ttcctgccat cctgagtttc ccacttgatt acccgttaag tcccccaaag atgagattta cctgtgagat gtttcatccc aacatctacc ctgatgggag agtctgcatt tccatcctcc acgcgccagg cgatgacccc atgggctacg agagcagcgc ggagcggtgg agtcctgtgc agagtgtgga gaagatcctg ctgtcggtgg tgagcatgct ggcagagccc aatgacgaaa gtggagctaa cgtggatgcg tccaaaatgt ggcgcgatga ccgggagcag ttctataaga ttgccaagca gatcgtccag aagtctctgg gactgtga. It is sometimes possible for the material contained within the vial of "UBE2G2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.