Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPAG9 cdna clone

SPAG9 cDNA Clone

Gene Names
SPAG9; JLP; CT89; HLC4; HLC6; JIP4; PHET; PIG6; HLC-6; JIP-4
Synonyms
SPAG9; SPAG9 cDNA Clone; SPAG9 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtcctggatgcatgctgctgtttgtgtttggctttgttggcggggcggtggtcattaattctgctatcttagtatctctctctgttttgctgcttgtgcacttttctatttctaccggtgtgccagctctgacgcagaacctaccaaggatactcagaaaagaacgccctatatcattaggaattttcccattacctgctggagatggattgcttacacctgatgctcagaaaggaggagagacccctggatctgagcaatggaaatttcaggaattaagtcaaccacgttctcataccagcctgaaggtcagcaatagtcctgaacctcagaaggctgtagaacaggaggtgagaatggtgcttcttaacattttgcaaaaagtatactaa
Sequence Length
396
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
128,607 Da
NCBI Official Full Name
Homo sapiens sperm associated antigen 9, mRNA
NCBI Official Synonym Full Names
sperm associated antigen 9
NCBI Official Symbol
SPAG9
NCBI Official Synonym Symbols
JLP; CT89; HLC4; HLC6; JIP4; PHET; PIG6; HLC-6; JIP-4
NCBI Protein Information
C-Jun-amino-terminal kinase-interacting protein 4
UniProt Protein Name
C-Jun-amino-terminal kinase-interacting protein 4
UniProt Gene Name
SPAG9
UniProt Synonym Gene Names
HSS; KIAA0516; MAPK8IP4; SYD1; JIP-4; JNK-interacting protein 4; CT89; HLC-6; JLP; PHET
UniProt Entry Name
JIP4_HUMAN

NCBI Description

This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]

Uniprot Description

JIP4: The JNK-interacting protein (JIP) group of scaffold proteins selectively mediates JNK signaling by aggregating specific components of the MAPK cascade to form a functional JNK signaling module. Isoform 5 may play a role in spermatozoa-egg- interaction. Homooligomer. Interacts with MAX, MAPK8, MAPK9, MAPK10, MAPK14, MAP3K3, MYC, KNS2 and MAP2K4. Interaction with KNS2 is important in the formation of ternary complex with MAPK8. Interacts with NFKB1. Isoform 3 is increased in systemic sclerosis fibroblasts. Isoform 5 is expressed only in testis on the round spermatids of stage I, II and II. Isoform 5 is absent in spermatogonia and spermatocyte. Isoform 3 is expressed in testis. Isoform 4 is expressed in testis and in acute myeloid leukemia (AML) patients. Belongs to the JIP scaffold family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: 17q21.33

Cellular Component: cytoplasm; cytosol; integral to membrane; microtubule organizing center

Molecular Function: JUN kinase binding; kinesin binding; MAP-kinase scaffold activity; protein binding; receptor signaling complex scaffold activity

Biological Process: activation of JNK activity; positive regulation of cell migration; positive regulation of muscle cell differentiation; retrograde transport, endosome to Golgi; spermatogenesis

Research Articles on SPAG9

Similar Products

Product Notes

The SPAG9 spag9 (Catalog #AAA1273156) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtcctg gatgcatgct gctgtttgtg tttggctttg ttggcggggc ggtggtcatt aattctgcta tcttagtatc tctctctgtt ttgctgcttg tgcacttttc tatttctacc ggtgtgccag ctctgacgca gaacctacca aggatactca gaaaagaacg ccctatatca ttaggaattt tcccattacc tgctggagat ggattgctta cacctgatgc tcagaaagga ggagagaccc ctggatctga gcaatggaaa tttcaggaat taagtcaacc acgttctcat accagcctga aggtcagcaa tagtcctgaa cctcagaagg ctgtagaaca ggaggtgaga atggtgcttc ttaacatttt gcaaaaagta tactaa. It is sometimes possible for the material contained within the vial of "SPAG9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.