EME1 cdna clone
EME1 cDNA Clone
Gene Names
EME1; MMS4L; SLX2A
Synonyms
EME1; EME1 cDNA Clone; EME1 cdna clone
Sequence
atggctctaaagaagtcatcaccctcactggattctggtgatagtgactctgaggagttgccaacatttgcctttctgaagaaggaaccatcttcaacaaagaggagacagcctgaaagggaagagaagattgtagtggttgacatctcagattgtgaagcctcctgtcctccagcaccagagttattttcaccacctgtcccagacatagctgaaactgtcacacaaacacagccagtcaggttgctaagcagtgaaagtgaagatgaagaagaatttattcctctggctcaaaggcttacatgtaagtttctgacccacaagcaactgagccctgaggactctagctccccagttaaaagtgttttggatcatcaaaataatgaaggtgcatcatgtgactggaaaaagccctttccaaagatccctgaagttcccctccatgataccccagagaggagtgcagcagataacaaggacctgatcttagatccatgctgtcagcttccagcctacctgtctacctgccctggccagagcagcagcttggcagtaaccaaaacaaattctgacatccttccaccccagaagaaaaccaagccgagtcagaaggtccagggaagaggctcacacggatgccggcagcagagacaagcaaggcagaaggaaagcaccctgagaagacaggaaagaaagaatgcagcactggttaccaggatgaaagcccagaggccagaggaatgcttaaaacacatcattgtagtgctggatccagtgctcttacagatggaaggtgggggccagctcctaggagcactgcagaccatggagtgccgctgtgtgattgaggcgcaggctgtgccttgcagtgtcacttggaggagaagggctgggccgtctgaggacagagaggactgggtggaggagccaacagtactggtgttgctccgggcagaggcatttgtgtccatgatcgacaatggaaagcagggaagcctggacagcactatgaaagggaaggaaacgcttcagggctttgtaactgacatcacagcaaagacagcagggaaagctctgtcactggtgattgtggatcaggagaaatgcttcagcctggagctgctgttctttgatttcctcccctgcaccagtgctcagaatcctccaagaagagggaaacagggagcaaataaacagaccaagaagcagcagcagagacaaccagaggccagcatagggtccatggtatccagggtagacgctgaagaggcattggtggatctgcagctacacacagaagcccaggctcaaattgtgcagagctggaaagagctggccgacttcacatgcgcattcacaaaggctgtggctgaggcgcccttcaagaagctccgagatgaaactaccttctccttctgtctggagagtgactgggctggaggggtgaaggtggaccttgctggcaggggactcgcactagtctggaggagacagattcagcagctgaaccgagtcagcctggaaatggccagtgcagttgtgaatgcctatccctccccacagctcctggtacaggcttatcagcagtgtttttcggataaagaacgccagaatttgctcgcagacatacaggtgcgccgtggggaaggtgtgacatccacttctcgccgcattggaccagaactatccaggcgtatctaccttcagatgaccactttacagccacatctctctttagatagtgctgactga
Sequence Length
1752
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
64,779 Da
NCBI Official Full Name
Homo sapiens essential meiotic endonuclease 1 homolog 1 (S. pombe), mRNA
NCBI Official Synonym Full Names
essential meiotic structure-specific endonuclease 1
NCBI Official Symbol
EME1
NCBI Official Synonym Symbols
MMS4L; SLX2A
NCBI Protein Information
crossover junction endonuclease EME1
UniProt Protein Name
Crossover junction endonuclease EME1
Protein Family
UniProt Gene Name
EME1
UniProt Synonym Gene Names
MMS4; hMMS4
UniProt Entry Name
EME1_HUMAN
NCBI Description
This gene encodes a protein that complexes with methyl methanesulfonate-sensitive UV-sensitive 81 protein to form an endonuclease complex. The encoded protein interacts with specifc DNA structures including nicked Holliday junctions, 3'-flap structures and aberrant replication fork structures. This protein may be involved in repairing DNA damage and in maintaining genomic stability. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Uniprot Description
EME1: Interacts with MUS81 to form a DNA structure-specific endonuclease with substrate preference for branched DNA structures with a 5'-end at the branch nick. Typical substrates include 3'- flap structures, replication forks and nicked Holliday junctions. May be required in mitosis for the processing of stalled or collapsed replication forks. Belongs to the EME1/MMS4 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Deoxyribonuclease; Nucleolus; EC 3.1.22.-
Chromosomal Location of Human Ortholog: 17q21.33
Cellular Component: cytoplasm; nucleoplasm; nucleus
Molecular Function: endodeoxyribonuclease activity; protein binding
Research Articles on EME1
Similar Products
Product Notes
The EME1 eme1 (Catalog #AAA1273128) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctctaa agaagtcatc accctcactg gattctggtg atagtgactc tgaggagttg ccaacatttg cctttctgaa gaaggaacca tcttcaacaa agaggagaca gcctgaaagg gaagagaaga ttgtagtggt tgacatctca gattgtgaag cctcctgtcc tccagcacca gagttatttt caccacctgt cccagacata gctgaaactg tcacacaaac acagccagtc aggttgctaa gcagtgaaag tgaagatgaa gaagaattta ttcctctggc tcaaaggctt acatgtaagt ttctgaccca caagcaactg agccctgagg actctagctc cccagttaaa agtgttttgg atcatcaaaa taatgaaggt gcatcatgtg actggaaaaa gccctttcca aagatccctg aagttcccct ccatgatacc ccagagagga gtgcagcaga taacaaggac ctgatcttag atccatgctg tcagcttcca gcctacctgt ctacctgccc tggccagagc agcagcttgg cagtaaccaa aacaaattct gacatccttc caccccagaa gaaaaccaag ccgagtcaga aggtccaggg aagaggctca cacggatgcc ggcagcagag acaagcaagg cagaaggaaa gcaccctgag aagacaggaa agaaagaatg cagcactggt taccaggatg aaagcccaga ggccagagga atgcttaaaa cacatcattg tagtgctgga tccagtgctc ttacagatgg aaggtggggg ccagctccta ggagcactgc agaccatgga gtgccgctgt gtgattgagg cgcaggctgt gccttgcagt gtcacttgga ggagaagggc tgggccgtct gaggacagag aggactgggt ggaggagcca acagtactgg tgttgctccg ggcagaggca tttgtgtcca tgatcgacaa tggaaagcag ggaagcctgg acagcactat gaaagggaag gaaacgcttc agggctttgt aactgacatc acagcaaaga cagcagggaa agctctgtca ctggtgattg tggatcagga gaaatgcttc agcctggagc tgctgttctt tgatttcctc ccctgcacca gtgctcagaa tcctccaaga agagggaaac agggagcaaa taaacagacc aagaagcagc agcagagaca accagaggcc agcatagggt ccatggtatc cagggtagac gctgaagagg cattggtgga tctgcagcta cacacagaag cccaggctca aattgtgcag agctggaaag agctggccga cttcacatgc gcattcacaa aggctgtggc tgaggcgccc ttcaagaagc tccgagatga aactaccttc tccttctgtc tggagagtga ctgggctgga ggggtgaagg tggaccttgc tggcagggga ctcgcactag tctggaggag acagattcag cagctgaacc gagtcagcct ggaaatggcc agtgcagttg tgaatgccta tccctcccca cagctcctgg tacaggctta tcagcagtgt ttttcggata aagaacgcca gaatttgctc gcagacatac aggtgcgccg tggggaaggt gtgacatcca cttctcgccg cattggacca gaactatcca ggcgtatcta ccttcagatg accactttac agccacatct ctctttagat agtgctgact ga. It is sometimes possible for the material contained within the vial of "EME1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
