Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TSNAX cdna clone

TSNAX cDNA Clone

Gene Names
TSNAX; TRAX
Synonyms
TSNAX; TSNAX cDNA Clone; TSNAX cdna clone
Ordering
For Research Use Only!
Sequence
atgagcaacaaagaaggatcaggagggttcaggaaaaggaagcatgacaatttcccacataaccaaagaagagaagggaaggatgttaattcatcttcacccgtgatgttggcctttaaatcatttcagcaggaacttgatgcaaggcatgacaaatatgagagacttgtgaaacttagtcgggatataactgttgaaagtaaaaggacaatttttctcctccataggattacaagtgctcctgatatggaagatatattgactgaatcagaaattaaattggatggtgtcagacaaaagatattccaggtagcccaagagctatcaggggaagatatgcatcagttccatcgagccattactacaggactacaggaatatgtggaagctgtctcttttcaacacttcatcaaaacacgatcattaattagtatggatgaaattaataaacaattgatatttacgactgaagacaatgggaaagaaaataaaactccctcctctgatgcacaggataagcagtttggtacttggagactgagagtcacacctgtcgattaccttctgggagtggctgacttaactggagaattgatgcggatgtgtattaacagtgtggggaatggggacattgataccccctttgaagtgagccagtttttacgtcaggtttatgatgggttttcattcattggcaacactggaccttacgaggtttctaagaagctgtataccttgaaacaaagtttggccaaagtggagaatgcttgttatgccttgaaagtcagagggtcagaaattccaaaacatatgttggcagatgtgttttcagttaaaacagaaatgatagatcaagaagagggcatttcttag
Sequence Length
873
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,112 Da
NCBI Official Full Name
Homo sapiens translin-associated factor X, mRNA
NCBI Official Synonym Full Names
translin associated factor X
NCBI Official Symbol
TSNAX
NCBI Official Synonym Symbols
TRAX
NCBI Protein Information
translin-associated protein X
UniProt Protein Name
Translin-associated protein X
UniProt Gene Name
TSNAX
UniProt Synonym Gene Names
TRAX
UniProt Entry Name
TSNAX_HUMAN

NCBI Description

This gene encodes a protein which specifically interacts with translin, a DNA-binding protein that binds consensus sequences at breakpoint junctions of chromosomal translocations. The encoded protein contains bipartite nuclear targeting sequences that may provide nuclear transport for translin, which lacks any nuclear targeting motifs. [provided by RefSeq, Jul 2008]

Uniprot Description

TSNAX: Acts in combination with TSN as an endonuclease involved in the activation of the RNA-induced silencing complex (RISC). Possible role in spermatogenesis. Belongs to the translin family.

Protein type: DNA-binding; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 1q42.1

Cellular Component: cytosol; nucleus

Molecular Function: DNA binding; protein binding; protein transporter activity

Biological Process: RNA-mediated gene silencing

Research Articles on TSNAX

Similar Products

Product Notes

The TSNAX tsnax (Catalog #AAA1273059) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcaaca aagaaggatc aggagggttc aggaaaagga agcatgacaa tttcccacat aaccaaagaa gagaagggaa ggatgttaat tcatcttcac ccgtgatgtt ggcctttaaa tcatttcagc aggaacttga tgcaaggcat gacaaatatg agagacttgt gaaacttagt cgggatataa ctgttgaaag taaaaggaca atttttctcc tccataggat tacaagtgct cctgatatgg aagatatatt gactgaatca gaaattaaat tggatggtgt cagacaaaag atattccagg tagcccaaga gctatcaggg gaagatatgc atcagttcca tcgagccatt actacaggac tacaggaata tgtggaagct gtctcttttc aacacttcat caaaacacga tcattaatta gtatggatga aattaataaa caattgatat ttacgactga agacaatggg aaagaaaata aaactccctc ctctgatgca caggataagc agtttggtac ttggagactg agagtcacac ctgtcgatta ccttctggga gtggctgact taactggaga attgatgcgg atgtgtatta acagtgtggg gaatggggac attgataccc cctttgaagt gagccagttt ttacgtcagg tttatgatgg gttttcattc attggcaaca ctggacctta cgaggtttct aagaagctgt ataccttgaa acaaagtttg gccaaagtgg agaatgcttg ttatgccttg aaagtcagag ggtcagaaat tccaaaacat atgttggcag atgtgttttc agttaaaaca gaaatgatag atcaagaaga gggcatttct tag. It is sometimes possible for the material contained within the vial of "TSNAX, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.