Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZBED1 cdna clone

ZBED1 cDNA Clone

Gene Names
ZBED1; ALTE; DREF; TRAMP; hDREF
Synonyms
ZBED1; ZBED1 cDNA Clone; ZBED1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagaataaaagcctggagagctcccagacagacctgaagctggtggcccacccccgcgccaagagcaaggtgtggaagtatttcggcttcgacaccaacgccgagggatgcatcctgcagtggaagaaaatctactgccgcatctgcatggcccagatcgcctactccggaaacacctccaacctgtcctaccacctggagaagaaccaccccgaggaattctgcgagttcgtcaagagcaacacggagcagatgcgtgaagccttcgccaccgccttctccaagctgaagcccgagtcgtcccagcagcccgggcaggatgcgctggccgtcaaggccggccacggctacgacagcaagaagcagcaggagctgacggccgccgtgctgggcctcatctgcgaggggctgtacccagcctccatcgtggacgagcccaccttcaaggtgctgctgaagacggccgacccccggtatgagctgcccagccggaagtacatctctaccaaggccatccctgagaagtacggggccgtccgggaggtgatcctgaaggagctggccgaggccacctggtgtggcatctccaccgacatgtggaggagtgagaatcagaaccgcgcctacgtcacgctggccgcccacttcctgggcctgggcgcccccaactgcctgtccatgggctcccgctgcctgaagaccttcgaggtgcccgaagagaacacggcggagaccatcacgcgagtgctctatgaggtcttcatcgagtggggcatcagcgccaaggtcttcggggccaccaccaactatggcaaggacatcgtgaaggcgtgctccctgctggacgtcgcagtgcacatgccctgcctgggccacaccctcaatgccggcatccagcaggccttccagctcccgaagctgggggcgctgctgtcgcgctgccgcaaactggtggagtacttccagcagtctgccgtggccatgtacatgctctatgagaagcagaagcagcagaacgtggcccactgcatgctggtgagcaaccgcgtctcctggtgggggagcacgctggccatgctgcagcgcctcaaggagcagcagttcgtcatcgccggggtcttggtggaggacagcaacaaccaccacctcatgctggaggccagcgagtgggccaccatcgaggggctggtggagctcctgcagcccttcaagcaggtggccgagatgctgtcggcctccaggtaccccaccatcagcatggtgaagccgctgctgcacatgctcctgaacaccacgctcaacatcaaggagaccgactccaaggagctcagcatggccaaggaggtcatcgccaaggagctttccaagacctaccaggagacgcccgagatcgacatgtttctcaacgtggccaccttcctggacccccgctacaagaggctgcccttcctctccgccttcgagcggcagcaggtggagaatcgcgtggtggaagaggccaagggcctgctggacaaggtcaaagacggcggctaccggccggctgaggacaagatcttcccggtgcccgaggagcctcccgtcaagaagctcatgcggacatccacgccgccgcccgccagcgtcatcaacaacatgctggccgagatcttctgccagacaggcggcgtggaggaccaggaagagtggcatgcccaggtggtggaggagctgagcaacttcaagtcccagaaggtgcttggcctcaacgaagaccccctcaagtggtggtcagaccgcctggccctcttccccctgctgcccaaggtgctgcagaagtactggtgcgtgacggccacgcgcgtcgcccctgagcgtctcttcggatccgccgccaacgtggtcagcgccaagaggaaccggctggctcccgcgcacgtggacgagcaggtgtttctgtatgagaacgcccggagtggggcagaggcggaacccgaggaccaggacgagggggagtggggcctggaccaggagcaggtgttctccttgggggatggcgtcagcggcggtttctttggcattagggacagcagcttcctgtag
Sequence Length
2085
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
78,156 Da
NCBI Official Full Name
Homo sapiens zinc finger, BED-type containing 1, mRNA
NCBI Official Synonym Full Names
zinc finger BED-type containing 1
NCBI Official Symbol
ZBED1
NCBI Official Synonym Symbols
ALTE; DREF; TRAMP; hDREF
NCBI Protein Information
zinc finger BED domain-containing protein 1
UniProt Protein Name
Zinc finger BED domain-containing protein 1
UniProt Gene Name
ZBED1
UniProt Synonym Gene Names
ALTE; DREF; KIAA0785; TRAMP
UniProt Entry Name
ZBED1_HUMAN

NCBI Description

This gene is located in the pseudoautosomal region 1 (PAR1) of X and Y chromosomes. It was earlier identified as a gene with similarity to Ac transposable elements, however, was found not to have transposase activity. Later studies show that this gene product is localized in the nucleus and functions as a transcription factor. It binds to DNA elements found in the promoter regions of several genes related to cell proliferation, such as histone H1, hence may have a role in regulating genes related to cell proliferation. Alternatively spliced transcript variants with different 5' untranslated region have been found for this gene. [provided by RefSeq, Jan 2010]

Uniprot Description

ZBED1: Binds to 5'-TGTCG[CT]GA[CT]A-3' DNA elements found in the promoter regions of a number of genes related to cell proliferation. Binds to the histone H1 promoter and stimulates transcription. Was first identified as gene weakly similar to Ac transposable elements, but does not code for any transposase activity.

Protein type: Transcription factor

Chromosomal Location of Human Ortholog: Xp22.33;Yp11

Cellular Component: actin cytoskeleton; cytoplasm; nuclear chromosome; nucleus

Molecular Function: protein binding; transcription factor activity; transposase activity

Biological Process: regulation of transcription from RNA polymerase II promoter

Research Articles on ZBED1

Similar Products

Product Notes

The ZBED1 zbed1 (Catalog #AAA1273040) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaata aaagcctgga gagctcccag acagacctga agctggtggc ccacccccgc gccaagagca aggtgtggaa gtatttcggc ttcgacacca acgccgaggg atgcatcctg cagtggaaga aaatctactg ccgcatctgc atggcccaga tcgcctactc cggaaacacc tccaacctgt cctaccacct ggagaagaac caccccgagg aattctgcga gttcgtcaag agcaacacgg agcagatgcg tgaagccttc gccaccgcct tctccaagct gaagcccgag tcgtcccagc agcccgggca ggatgcgctg gccgtcaagg ccggccacgg ctacgacagc aagaagcagc aggagctgac ggccgccgtg ctgggcctca tctgcgaggg gctgtaccca gcctccatcg tggacgagcc caccttcaag gtgctgctga agacggccga cccccggtat gagctgccca gccggaagta catctctacc aaggccatcc ctgagaagta cggggccgtc cgggaggtga tcctgaagga gctggccgag gccacctggt gtggcatctc caccgacatg tggaggagtg agaatcagaa ccgcgcctac gtcacgctgg ccgcccactt cctgggcctg ggcgccccca actgcctgtc catgggctcc cgctgcctga agaccttcga ggtgcccgaa gagaacacgg cggagaccat cacgcgagtg ctctatgagg tcttcatcga gtggggcatc agcgccaagg tcttcggggc caccaccaac tatggcaagg acatcgtgaa ggcgtgctcc ctgctggacg tcgcagtgca catgccctgc ctgggccaca ccctcaatgc cggcatccag caggccttcc agctcccgaa gctgggggcg ctgctgtcgc gctgccgcaa actggtggag tacttccagc agtctgccgt ggccatgtac atgctctatg agaagcagaa gcagcagaac gtggcccact gcatgctggt gagcaaccgc gtctcctggt gggggagcac gctggccatg ctgcagcgcc tcaaggagca gcagttcgtc atcgccgggg tcttggtgga ggacagcaac aaccaccacc tcatgctgga ggccagcgag tgggccacca tcgaggggct ggtggagctc ctgcagccct tcaagcaggt ggccgagatg ctgtcggcct ccaggtaccc caccatcagc atggtgaagc cgctgctgca catgctcctg aacaccacgc tcaacatcaa ggagaccgac tccaaggagc tcagcatggc caaggaggtc atcgccaagg agctttccaa gacctaccag gagacgcccg agatcgacat gtttctcaac gtggccacct tcctggaccc ccgctacaag aggctgccct tcctctccgc cttcgagcgg cagcaggtgg agaatcgcgt ggtggaagag gccaagggcc tgctggacaa ggtcaaagac ggcggctacc ggccggctga ggacaagatc ttcccggtgc ccgaggagcc tcccgtcaag aagctcatgc ggacatccac gccgccgccc gccagcgtca tcaacaacat gctggccgag atcttctgcc agacaggcgg cgtggaggac caggaagagt ggcatgccca ggtggtggag gagctgagca acttcaagtc ccagaaggtg cttggcctca acgaagaccc cctcaagtgg tggtcagacc gcctggccct cttccccctg ctgcccaagg tgctgcagaa gtactggtgc gtgacggcca cgcgcgtcgc ccctgagcgt ctcttcggat ccgccgccaa cgtggtcagc gccaagagga accggctggc tcccgcgcac gtggacgagc aggtgtttct gtatgagaac gcccggagtg gggcagaggc ggaacccgag gaccaggacg agggggagtg gggcctggac caggagcagg tgttctcctt gggggatggc gtcagcggcg gtttctttgg cattagggac agcagcttcc tgtag. It is sometimes possible for the material contained within the vial of "ZBED1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.