Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF2S3 cdna clone

EIF2S3 cDNA Clone

Gene Names
EIF2S3; EIF2; EIF2G; eIF-2gA; EIF2gamma
Synonyms
EIF2S3; EIF2S3 cDNA Clone; EIF2S3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgggcggagaagctggagtgactctagggcagccgcatctttcgcgtcaggatctcaccaccttggatgttaccaagttgacgccactttcacacgaagttatcagcagacaagccacaattaacataggtacaattggtcatgtagctcatgggaaatccacagtcgtcaaagctatttctggagttcatactgtcaggttcaaaaatgaactagaaagaaatattacaatcaagcttggatatgctaatgctaagatttataagcttgatgacccaagttgccctcggccagaatgttatagatcttgtgggagcagtacacctgacgagtttcctacggacattccagggaccaaagggaacttcaaattagtcagacatgtttcctttgttgactgtcctggccacgatattttgatggctactatgctgaacggtgcagcagtgatggatgcagctcttctgttgatagctggtaatgaatcttgccctcagcctcagacatcggaacacctggctgctatagagatcatgaaactgaagcatattttgattctacaaaataaaattgatttggtaaaagaaagtcaggctaaagaacaatacgagcagatccttgcatttgtccaaggtacagtagcagagggagctcccattattccaatttcagctcagctgaaatacaatattgaagttgtttgtgagtacatagtaaagaaaattccagtacccccaagagactttacttcagagccccggcttattgttattagatcttttgatgtcaacaaacctggctgtgaagttgatgaccttaagggaggtgtagctggtggtagtatcctaaaaggagtattaaaggtgggccaggagatagaagtaagacctggtattgtttccaaagatagtgaaggaaaactcatgtgtaaaccaatcttttccaaaattgtatcactttttgcggagcataatgatctgcaatatgctgctccaggcggtcttattggagttggaacaaaaattgaccccactttgtgccgggctgacagaatggtggggcaagtacttggtgcagtcggagctttacctgagatattcacagaattggaaatttcctatttcctgcttagacggcttctaggtgtacgcactgaaggagacaagaaagcagcaaaggttcaaaagctgtctaagaatgaagtgctcatggtgaacataggatccctgtcaacaggagggagagttagtgctgtcaaggccgatttgggtaaaattgttttgaccaatccagtgtgcacagaggtaggagaaaaaattgcccttagccgaagagttgaaaaacactggcgtttaattggttggggtcagataagaagaggagtgacaatcaagccaacagtagatgatgactga
Sequence Length
1419
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,109 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 2 subunit gamma
NCBI Official Symbol
EIF2S3
NCBI Official Synonym Symbols
EIF2; EIF2G; eIF-2gA; EIF2gamma
NCBI Protein Information
eukaryotic translation initiation factor 2 subunit 3
UniProt Protein Name
Eukaryotic translation initiation factor 2 subunit 3
UniProt Gene Name
EIF2S3
UniProt Synonym Gene Names
EIF2G; eIF-2-gamma X; eIF-2gX
UniProt Entry Name
IF2G_HUMAN

NCBI Description

The protein encoded by this gene is the largest subunit of a heterotrimeric GTP-binding protein involved in the recruitment of methionyl-tRNA(i) to the 40 S ribosomal subunit. [provided by RefSeq, Jan 2010]

Uniprot Description

eIF2-gamma: eIF-2 functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA. This complex binds to a 40S ribosomal subunit, followed by mRNA binding to form a 43S preinitiation complex. Junction of the 60S ribosomal subunit to form the 80S initiation complex is preceded by hydrolysis of the GTP bound to eIF-2 and release of an eIF-2-GDP binary complex. In order for eIF-2 to recycle and catalyze another round of initiation, the GDP bound to eIF-2 must exchange with GTP by way of a reaction catalyzed by eIF-2B.

Protein type: Translation initiation; Translation

Chromosomal Location of Human Ortholog: Xp22.2-p22.1

Cellular Component: cell-cell adherens junction; cytoplasm; cytosol; nucleus

Molecular Function: protein binding; translation factor activity, nucleic acid binding; translation initiation factor activity

Biological Process: formation of translation preinitiation complex; translational initiation; transmembrane transport

Research Articles on EIF2S3

Similar Products

Product Notes

The EIF2S3 eif2s3 (Catalog #AAA1273037) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggcg gagaagctgg agtgactcta gggcagccgc atctttcgcg tcaggatctc accaccttgg atgttaccaa gttgacgcca ctttcacacg aagttatcag cagacaagcc acaattaaca taggtacaat tggtcatgta gctcatggga aatccacagt cgtcaaagct atttctggag ttcatactgt caggttcaaa aatgaactag aaagaaatat tacaatcaag cttggatatg ctaatgctaa gatttataag cttgatgacc caagttgccc tcggccagaa tgttatagat cttgtgggag cagtacacct gacgagtttc ctacggacat tccagggacc aaagggaact tcaaattagt cagacatgtt tcctttgttg actgtcctgg ccacgatatt ttgatggcta ctatgctgaa cggtgcagca gtgatggatg cagctcttct gttgatagct ggtaatgaat cttgccctca gcctcagaca tcggaacacc tggctgctat agagatcatg aaactgaagc atattttgat tctacaaaat aaaattgatt tggtaaaaga aagtcaggct aaagaacaat acgagcagat ccttgcattt gtccaaggta cagtagcaga gggagctccc attattccaa tttcagctca gctgaaatac aatattgaag ttgtttgtga gtacatagta aagaaaattc cagtaccccc aagagacttt acttcagagc cccggcttat tgttattaga tcttttgatg tcaacaaacc tggctgtgaa gttgatgacc ttaagggagg tgtagctggt ggtagtatcc taaaaggagt attaaaggtg ggccaggaga tagaagtaag acctggtatt gtttccaaag atagtgaagg aaaactcatg tgtaaaccaa tcttttccaa aattgtatca ctttttgcgg agcataatga tctgcaatat gctgctccag gcggtcttat tggagttgga acaaaaattg accccacttt gtgccgggct gacagaatgg tggggcaagt acttggtgca gtcggagctt tacctgagat attcacagaa ttggaaattt cctatttcct gcttagacgg cttctaggtg tacgcactga aggagacaag aaagcagcaa aggttcaaaa gctgtctaag aatgaagtgc tcatggtgaa cataggatcc ctgtcaacag gagggagagt tagtgctgtc aaggccgatt tgggtaaaat tgttttgacc aatccagtgt gcacagaggt aggagaaaaa attgccctta gccgaagagt tgaaaaacac tggcgtttaa ttggttgggg tcagataaga agaggagtga caatcaagcc aacagtagat gatgactga. It is sometimes possible for the material contained within the vial of "EIF2S3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.