Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IHH cdna clone

IHH cDNA Clone

Gene Names
IHH; BDA1; HHG2
Synonyms
IHH; IHH cDNA Clone; IHH cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccagtggcccggtgtgaagctgcgggtgaccgagggctgggacgaggacggccaccactcagaggagtccctgcattatgagggccgcgcggtggacatcaccacatcagaccgcgaccgcaataagtatggactgctggcgcgcttggcagtggaggccggctttgactgggtgtattacgagtcaaaggcccacgtgcattgctccgtcaagtccgagcactcggccgcagccaagacaggcggctgcttccctgccggagcccaggtacgcctggagagtggggcgcgtgtggccttgtcagccgtgaggccgggagaccgtgtgctggccatgggggaggatgggagccccaccttcagcgatgtgctcattttcctggaccgcgagcctcacaggctgagagccttccaggtcatcgagactcaggaccccccacgccgcctggcactcacacccgctcacctgctctttacggctgacaatcacacggagccggcagcccgcttccgggccacatttgccagccacgtgcagcctggccagtacgtgctggtggctggggtgccaggcctgcagcctgcccgcgtggcagctgtctctacacacgtggccctcggggcctacgccccgctcacaaagcatgggacactggtggtggaggatgtggtggcatcctgcttcgcggccgtggctgaccaccacctggctcagttggccttctggcccctgagactctttcacagcttggcatggggcagctggaccccgggggagggtgtgcattggtacccccagctgctctaccgcctggggcgtctcctgctagaagagggcagcttccacccactgggcatgtccggggcagggagctga
Sequence Length
882
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,251 Da
NCBI Official Full Name
Homo sapiens Indian hedgehog homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
indian hedgehog
NCBI Official Symbol
IHH
NCBI Official Synonym Symbols
BDA1; HHG2
NCBI Protein Information
indian hedgehog protein
UniProt Protein Name
Indian hedgehog protein
Protein Family
UniProt Gene Name
IHH
UniProt Synonym Gene Names
IHH
UniProt Entry Name
IHH_HUMAN

NCBI Description

This gene encodes a member of the hedgehog family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including an N-terminal fragment that is involved in signaling. Hedgehog family proteins are essential secreted signaling molecules that regulate a variety of developmental processes including growth, patterning and morphogenesis. The protein encoded by this gene specifically plays a role in bone growth and differentiation. Mutations in this gene are the cause of brachydactyly type A1, which is characterized by shortening or malformation of the fingers and toes. Mutations in this gene are also the cause of acrocapitofemoral dysplasia. [provided by RefSeq, Nov 2015]

Uniprot Description

IHH: Intercellular signal essential for a variety of patterning events during development. Binds to the patched (PTC) receptor, which functions in association with smoothened (SMO), to activate the transcription of target genes. Implicated in endochondral ossification: may regulate the balance between growth and ossification of the developing bones. Induces the expression of parathyroid hormone-related protein (PTHRP). Expressed in embryonic lung, and in adult kidney and liver. Belongs to the hedgehog family.

Chromosomal Location of Human Ortholog: 2q33-q35

Cellular Component: plasma membrane

Molecular Function: calcium ion binding; patched binding

Biological Process: heart looping; negative regulation of alpha-beta T cell differentiation; negative regulation of immature T cell proliferation in the thymus; negative regulation of T cell differentiation in the thymus; positive regulation of alpha-beta T cell differentiation; positive regulation of smoothened signaling pathway; positive regulation of T cell differentiation in the thymus; skeletal development; smoothened signaling pathway

Disease: Acrocapitofemoral Dysplasia; Brachydactyly, Type A1

Research Articles on IHH

Similar Products

Product Notes

The IHH ihh (Catalog #AAA1273034) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccagt ggcccggtgt gaagctgcgg gtgaccgagg gctgggacga ggacggccac cactcagagg agtccctgca ttatgagggc cgcgcggtgg acatcaccac atcagaccgc gaccgcaata agtatggact gctggcgcgc ttggcagtgg aggccggctt tgactgggtg tattacgagt caaaggccca cgtgcattgc tccgtcaagt ccgagcactc ggccgcagcc aagacaggcg gctgcttccc tgccggagcc caggtacgcc tggagagtgg ggcgcgtgtg gccttgtcag ccgtgaggcc gggagaccgt gtgctggcca tgggggagga tgggagcccc accttcagcg atgtgctcat tttcctggac cgcgagcctc acaggctgag agccttccag gtcatcgaga ctcaggaccc cccacgccgc ctggcactca cacccgctca cctgctcttt acggctgaca atcacacgga gccggcagcc cgcttccggg ccacatttgc cagccacgtg cagcctggcc agtacgtgct ggtggctggg gtgccaggcc tgcagcctgc ccgcgtggca gctgtctcta cacacgtggc cctcggggcc tacgccccgc tcacaaagca tgggacactg gtggtggagg atgtggtggc atcctgcttc gcggccgtgg ctgaccacca cctggctcag ttggccttct ggcccctgag actctttcac agcttggcat ggggcagctg gaccccgggg gagggtgtgc attggtaccc ccagctgctc taccgcctgg ggcgtctcct gctagaagag ggcagcttcc acccactggg catgtccggg gcagggagct ga. It is sometimes possible for the material contained within the vial of "IHH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.