Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FDX1L cdna clone

FDX1L cDNA Clone

Gene Names
FDX1L; FDX2
Synonyms
FDX1L; FDX1L cDNA Clone; FDX1L cdna clone
Ordering
For Research Use Only!
Sequence
atggccgcctccatggcccggggaggcgtgagtgccagggttctactgcaggctgccaggggcacctggtggaacagacctgggggcacttccgggtcgggggagggggtggcgctggggacaaccagaaagtttcaagcgacaggctcgcgcccggctggagaggaggacgcgggcggcccggagcggcccggggacgtggtgaacgtggtgttcgtagaccgctcaggccagcggatcccagtgagtggcagagtcggggacaatgttcttcacctggcccagcgccacggggtggacctggaaggggcctgtgaagcctccctggcctgctccacctgccatgtgtatgtgagtgaagaccacctggatctcctgcctcctcccgaggagagggaagacgacatgctagacatggcccccctcctccaggagaactcgcggctgggctgccagattgtgctgacaccggagctggaaggagcggaattcaccctgcccaagatcaccaggaacttctacgtggatggccatgtccccaagccccactga
Sequence Length
552
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,298 Da
NCBI Official Full Name
Homo sapiens ferredoxin 1-like, mRNA
NCBI Official Synonym Full Names
ferredoxin 1 like
NCBI Official Symbol
FDX1L
NCBI Official Synonym Symbols
FDX2
NCBI Protein Information
adrenodoxin-like protein, mitochondrial
UniProt Protein Name
Adrenodoxin-like protein, mitochondrial
UniProt Gene Name
FDX1L
UniProt Synonym Gene Names
FDX2
UniProt Entry Name
ADXL_HUMAN

NCBI Description

This gene encodes a member of the ferredoxin family. The encoded protein contains a 2Fe-2S ferredoxin-type domain and is essential for heme A and Fe/S protein biosynthesis. Mutation in FDX1L gene is associated with mitochondrial muscle myopathy. [provided by RefSeq, Sep 2014]

Uniprot Description

FDX1L: Essential for heme A and Fe/S protein biosynthesis. Belongs to the adrenodoxin/putidaredoxin family.

Protein type: Oxidoreductase; Mitochondrial

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: mitochondrial matrix

Molecular Function: electron carrier activity; protein binding

Biological Process: C21-steroid hormone biosynthetic process; sterol metabolic process

Research Articles on FDX1L

Similar Products

Product Notes

The FDX1L fdx1l (Catalog #AAA1272958) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcct ccatggcccg gggaggcgtg agtgccaggg ttctactgca ggctgccagg ggcacctggt ggaacagacc tgggggcact tccgggtcgg gggagggggt ggcgctgggg acaaccagaa agtttcaagc gacaggctcg cgcccggctg gagaggagga cgcgggcggc ccggagcggc ccggggacgt ggtgaacgtg gtgttcgtag accgctcagg ccagcggatc ccagtgagtg gcagagtcgg ggacaatgtt cttcacctgg cccagcgcca cggggtggac ctggaagggg cctgtgaagc ctccctggcc tgctccacct gccatgtgta tgtgagtgaa gaccacctgg atctcctgcc tcctcccgag gagagggaag acgacatgct agacatggcc cccctcctcc aggagaactc gcggctgggc tgccagattg tgctgacacc ggagctggaa ggagcggaat tcaccctgcc caagatcacc aggaacttct acgtggatgg ccatgtcccc aagccccact ga. It is sometimes possible for the material contained within the vial of "FDX1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.