Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MTHFD2L cdna clone

MTHFD2L cDNA Clone

Synonyms
MTHFD2L; MTHFD2L cDNA Clone; MTHFD2L cdna clone
Ordering
For Research Use Only!
Sequence
atggacccaagagtcagcggtatattagttcagttaccactaccagaccacgttgatgagcgaacaatatgcaatggaattgccccagaaaaagatgtagatggatttcatattatcaatattggaagattgtgccttgatcagcattctctcatacctgccactgccagtgctgtttgggaaataataaaaagaacaggaattcaaacatttggaaaaaatgtggttgtggctggaagatccaagaacgtagggatgcctattgccatgcttttacacactgatggagagcatgaacggccaggaggtgatgcaactgtgacaatagctcacagatacacccccaaagagcaactgaagattcatacgcagctggcagatattatcatagttgctgcagagagatttcaccattttgcccaggacctctccaactcctga
Sequence Length
441
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,891 Da
NCBI Official Full Name
Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like, mRNA
NCBI Official Synonym Full Names
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
NCBI Official Symbol
MTHFD2L
NCBI Protein Information
probable bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase 2
UniProt Protein Name
Probable bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase 2
UniProt Gene Name
MTHFD2L
UniProt Synonym Gene Names
MTHFD2-like
UniProt Entry Name
MTD2L_HUMAN

Uniprot Description

MTHFD2L: Belongs to the tetrahydrofolate dehydrogenase/cyclohydrolase family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; EC 1.5.1.15; Mitochondrial; EC 3.5.4.9; Oxidoreductase

Chromosomal Location of Human Ortholog: 4q13.3

Cellular Component: cytosol; mitochondrial matrix; mitochondrion

Molecular Function: formate-tetrahydrofolate ligase activity; methenyltetrahydrofolate cyclohydrolase activity; methylenetetrahydrofolate dehydrogenase (NAD+) activity; methylenetetrahydrofolate dehydrogenase (NADP+) activity

Biological Process: folic acid metabolic process; one-carbon compound metabolic process

Research Articles on MTHFD2L

Similar Products

Product Notes

The MTHFD2L mthfd2l (Catalog #AAA1272869) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacccaa gagtcagcgg tatattagtt cagttaccac taccagacca cgttgatgag cgaacaatat gcaatggaat tgccccagaa aaagatgtag atggatttca tattatcaat attggaagat tgtgccttga tcagcattct ctcatacctg ccactgccag tgctgtttgg gaaataataa aaagaacagg aattcaaaca tttggaaaaa atgtggttgt ggctggaaga tccaagaacg tagggatgcc tattgccatg cttttacaca ctgatggaga gcatgaacgg ccaggaggtg atgcaactgt gacaatagct cacagataca cccccaaaga gcaactgaag attcatacgc agctggcaga tattatcata gttgctgcag agagatttca ccattttgcc caggacctct ccaactcctg a. It is sometimes possible for the material contained within the vial of "MTHFD2L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.