Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPME1 cdna clone

PPME1 cDNA Clone

Gene Names
PPME1; PME-1
Synonyms
PPME1; PPME1 cDNA Clone; PPME1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggccctcgaaaagagcatgcacctcggccgccttccctctcgcccacctctacccggcagcgggggcagtcagagcggagccaagatgcgaatgggccctggaagaaagcgggacttttcccctgttccttggagtcagtattttgagtccatggaagatgtagaagtagagaatgaaactggcaaggatacttttcgagtctacaagagtggttcagagggtccagtcctgctccttctgcatggaggaggtcattctgccctttcttgggctgtgttcacggcagcgattattagtagagttcagtgtaggattgtagctttggatctgcgaagtcatggtgaaacaaaggtcaagaatcctgaagatctgtctgcagaaacaatggcaaaagacgttggcaatgtggttgaagccatgtatggggaccttcctcctccaattatgctgattggacatagcatgggtggtgctattgcagtccacacagcatcatccaacctggtaccaagcctcttgggtctgtgcatgattgatgttgtagaaggtacagctatggatgcacttaatagcatgcagaatttcttacggggtcgtcctaaaaccttcaagtctctggagaatgctattgaatggagtgtgaagagtggccagattcgaaatctggagtctgcccgtgtctcaatggttggccaagtcaaacagtgtgaaggaattacaagtccagaaggctcaaaatctatagtggaaggaatcatagaggaagaagaagaagatgaggaaggaagtgagtctataagcaagaggaaaaaggaagatgacatggagaccaagaaagaccatccatacacctggagaattgaactggcaaaaacagaaaaatactgggacggctggttccgaggcttatccaatctctttcttagttgtcccattcctaaattgctgctcttggctggtgttgatagattggataaagatctgaccattggccagatgcaagggaagttccagatgcaggtcctaccccagtgtggccatgcagtccatgaggatgcccctgacaaggtagctgaagctgttgccactttcctgatccggcacaggtttgcagaacccatcggtggattccagtgtgtgtttcctggctgttag
Sequence Length
1161
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,870 Da
NCBI Official Full Name
Homo sapiens protein phosphatase methylesterase 1, mRNA
NCBI Official Synonym Full Names
protein phosphatase methylesterase 1
NCBI Official Symbol
PPME1
NCBI Official Synonym Symbols
PME-1
NCBI Protein Information
protein phosphatase methylesterase 1
UniProt Protein Name
Protein phosphatase methylesterase 1
Protein Family
UniProt Gene Name
PPME1
UniProt Synonym Gene Names
PME1; PME-1
UniProt Entry Name
PPME1_HUMAN

NCBI Description

This gene encodes a protein phosphatase methylesterase localized to the nucleus. The encoded protein acts on the protein phosphatase-2A catalytic subunit and supports the ERK pathway through dephosphorylation of regulatory proteins. It plays a role in malignant glioma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]

Uniprot Description

PPME1: Demethylates proteins that have been reversibly carboxymethylated. Demethylates PPP2CB (in vitro) and PPP2CA. Binding to PPP2CA displaces the manganese ion and inactivates the enzyme. Belongs to the AB hydrolase superfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Protein phosphatase, regulatory subunit; Hydrolase; EC 3.1.1.89

Chromosomal Location of Human Ortholog: 11q13.4

Cellular Component: cell-cell adherens junction

Molecular Function: protein C-terminal methylesterase activity; protein phosphatase 2A binding; protein phosphatase binding; protein phosphatase inhibitor activity; protein phosphatase type 2A regulator activity

Biological Process: protein amino acid demethylation

Research Articles on PPME1

Similar Products

Product Notes

The PPME1 ppme1 (Catalog #AAA1272809) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggccc tcgaaaagag catgcacctc ggccgccttc cctctcgccc acctctaccc ggcagcgggg gcagtcagag cggagccaag atgcgaatgg gccctggaag aaagcgggac ttttcccctg ttccttggag tcagtatttt gagtccatgg aagatgtaga agtagagaat gaaactggca aggatacttt tcgagtctac aagagtggtt cagagggtcc agtcctgctc cttctgcatg gaggaggtca ttctgccctt tcttgggctg tgttcacggc agcgattatt agtagagttc agtgtaggat tgtagctttg gatctgcgaa gtcatggtga aacaaaggtc aagaatcctg aagatctgtc tgcagaaaca atggcaaaag acgttggcaa tgtggttgaa gccatgtatg gggaccttcc tcctccaatt atgctgattg gacatagcat gggtggtgct attgcagtcc acacagcatc atccaacctg gtaccaagcc tcttgggtct gtgcatgatt gatgttgtag aaggtacagc tatggatgca cttaatagca tgcagaattt cttacggggt cgtcctaaaa ccttcaagtc tctggagaat gctattgaat ggagtgtgaa gagtggccag attcgaaatc tggagtctgc ccgtgtctca atggttggcc aagtcaaaca gtgtgaagga attacaagtc cagaaggctc aaaatctata gtggaaggaa tcatagagga agaagaagaa gatgaggaag gaagtgagtc tataagcaag aggaaaaagg aagatgacat ggagaccaag aaagaccatc catacacctg gagaattgaa ctggcaaaaa cagaaaaata ctgggacggc tggttccgag gcttatccaa tctctttctt agttgtccca ttcctaaatt gctgctcttg gctggtgttg atagattgga taaagatctg accattggcc agatgcaagg gaagttccag atgcaggtcc taccccagtg tggccatgca gtccatgagg atgcccctga caaggtagct gaagctgttg ccactttcct gatccggcac aggtttgcag aacccatcgg tggattccag tgtgtgtttc ctggctgtta g. It is sometimes possible for the material contained within the vial of "PPME1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.