Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLRD1 cdna clone

KLRD1 cDNA Clone

Gene Names
KLRD1; CD94
Synonyms
KLRD1; KLRD1 cDNA Clone; KLRD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagtgtttaagaccactctgtggaggttaatttctgggaccttagggataatatgcctttcgttgatggctacgttgggaattttgttgaaaaattcttttactaaactgagtattgagccagcatttactccaggacccaacatagaactccagaaagactctgactgctgttcttgccaagaaaaatgggttgggtaccggtgcaactgttacttcatttccagtgaacagaaaacttggaacgaaagtcggcatctctgtgcttctcagaaatccagcctgcttcagcttcaaaacacagatgaactggattttatgagctccagtcaacaattttactggattggactctcttacagtgaggagcacaccgcctggttgtgggagaatggctctgcactctcccagtatctatttccatcatttgaaacttttaatacaaagaactgcatagcgtataatccaaatggaaatgctttagatgaatcctgtgaagataaaaatcgttatatctgtaagcaacagctcatttaa
Sequence Length
540
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,109 Da
NCBI Official Full Name
Homo sapiens killer cell lectin-like receptor subfamily D, member 1, mRNA
NCBI Official Synonym Full Names
killer cell lectin like receptor D1
NCBI Official Symbol
KLRD1
NCBI Official Synonym Symbols
CD94
NCBI Protein Information
natural killer cells antigen CD94
UniProt Protein Name
Natural killer cells antigen CD94
UniProt Gene Name
KLRD1
UniProt Synonym Gene Names
CD94
UniProt Entry Name
KLRD1_HUMAN

NCBI Description

Natural killer (NK) cells are a distinct lineage of lymphocytes that mediate cytotoxic activity and secrete cytokines upon immune stimulation. Several genes of the C-type lectin superfamily, including members of the NKG2 family, are expressed by NK cells and may be involved in the regulation of NK cell function. KLRD1 (CD94) is an antigen preferentially expressed on NK cells and is classified as a type II membrane protein because it has an external C terminus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

KLRD1: Plays a role as a receptor for the recognition of MHC class I HLA-E molecules by NK cells and some cytotoxic T-cells. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p13

Cellular Component: plasma membrane; receptor complex

Molecular Function: protein binding; transmembrane receptor activity

Biological Process: cell surface receptor linked signal transduction; innate immune response; natural killer cell mediated immunity; regulation of immune response

Research Articles on KLRD1

Similar Products

Product Notes

The KLRD1 klrd1 (Catalog #AAA1272801) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagtgt ttaagaccac tctgtggagg ttaatttctg ggaccttagg gataatatgc ctttcgttga tggctacgtt gggaattttg ttgaaaaatt cttttactaa actgagtatt gagccagcat ttactccagg acccaacata gaactccaga aagactctga ctgctgttct tgccaagaaa aatgggttgg gtaccggtgc aactgttact tcatttccag tgaacagaaa acttggaacg aaagtcggca tctctgtgct tctcagaaat ccagcctgct tcagcttcaa aacacagatg aactggattt tatgagctcc agtcaacaat tttactggat tggactctct tacagtgagg agcacaccgc ctggttgtgg gagaatggct ctgcactctc ccagtatcta tttccatcat ttgaaacttt taatacaaag aactgcatag cgtataatcc aaatggaaat gctttagatg aatcctgtga agataaaaat cgttatatct gtaagcaaca gctcatttaa. It is sometimes possible for the material contained within the vial of "KLRD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.