Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCL5 cdna clone

CCL5 cDNA Clone

Gene Names
CCL5; SISd; eoCP; SCYA5; RANTES; TCP228; D17S136E; SIS-delta
Synonyms
CCL5; CCL5 cDNA Clone; CCL5 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggtctccgcggcagccctcgctgtcatcctcattgctactgccctctgcgctcctgcatctgcctccccatattcctcggacaccacaccctgctgctttgcctacattgcccgcccactgccccgtgcccacatcaaggagtatttctacaccagtggcaagtgctccaacccagcagtcgtctttgtcacccgaaagaaccgccaagtgtgtgccaacccagagaagaaatgggttcgggagtacatcaactctttggagatgagctag
Sequence Length
276
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,990 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) ligand 5, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine ligand 5
NCBI Official Symbol
CCL5
NCBI Official Synonym Symbols
SISd; eoCP; SCYA5; RANTES; TCP228; D17S136E; SIS-delta
NCBI Protein Information
C-C motif chemokine 5
UniProt Protein Name
C-C motif chemokine 5
Protein Family
UniProt Gene Name
CCL5
UniProt Synonym Gene Names
D17S136E; SCYA5; TCP228
UniProt Entry Name
CCL5_HUMAN

NCBI Description

This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, functions as a chemoattractant for blood monocytes, memory T helper cells and eosinophils. It causes the release of histamine from basophils and activates eosinophils. This cytokine is one of the major HIV-suppressive factors produced by CD8+ cells. It functions as one of the natural ligands for the chemokine receptor chemokine (C-C motif) receptor 5 (CCR5), and it suppresses in vitro replication of the R5 strains of HIV-1, which use CCR5 as a coreceptor. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]

Uniprot Description

CCL5: Chemoattractant for blood monocytes, memory T-helper cells and eosinophils. Causes the release of histamine from basophils and activates eosinophils. Binds to CCR1, CCR3, CCR4 and CCR5. One of the major HIV-suppressive factors produced by CD8+ T- cells. Recombinant RANTES protein induces a dose-dependent inhibition of different strains of HIV-1, HIV-2, and simian immunodeficiency virus (SIV). The processed form RANTES(3-68) acts as a natural chemotaxis inhibitor and is a more potent inhibitor of HIV-1-infection. The second processed form RANTES(4-68) exhibits reduced chemotactic and HIV-suppressive activity compared with RANTES(1-68) and RANTES(3-68) and is generated by an unidentified enzyme associated with monocytes and neutrophils. By mitogens. T-cell and macrophage specific. Belongs to the intercrine beta (chemokine CC) family.

Protein type: Motility/polarity/chemotaxis; Secreted, signal peptide; Secreted; Cell adhesion; Chemokine

Chromosomal Location of Human Ortholog: 17q12

Cellular Component: extracellular region; extracellular space

Molecular Function: CCR1 chemokine receptor binding; CCR4 chemokine receptor binding; CCR5 chemokine receptor binding; chemoattractant activity; chemokine activity; chemokine receptor antagonist activity; chemokine receptor binding; phosphoinositide phospholipase C activity; phospholipase activator activity; protein binding; protein homodimerization activity; protein kinase activity; protein self-association; receptor signaling protein tyrosine kinase activator activity

Biological Process: calcium ion transport; cell-cell signaling; cellular calcium ion homeostasis; cellular protein complex assembly; dendritic cell chemotaxis; eosinophil chemotaxis; exocytosis; G-protein coupled receptor protein signaling pathway; inflammatory response; leukocyte adhesion; lipopolysaccharide-mediated signaling pathway; macrophage chemotaxis; MAPKKK cascade; monocyte chemotaxis; negative regulation of G-protein coupled receptor protein signaling pathway; negative regulation of viral genome replication; neutrophil activation; neutrophil chemotaxis; phospholipase D activation; positive regulation of calcium ion transport; positive regulation of cell adhesion; positive regulation of cell migration; positive regulation of cell-cell adhesion mediated by integrin; positive regulation of cellular biosynthetic process; positive regulation of GTPase activity; positive regulation of homotypic cell-cell adhesion; positive regulation of inflammatory response; positive regulation of innate immune response; positive regulation of JAK-STAT cascade; positive regulation of phosphoinositide 3-kinase cascade; positive regulation of phosphorylation; positive regulation of smooth muscle cell migration; positive regulation of smooth muscle cell proliferation; positive regulation of T cell proliferation; positive regulation of tyrosine phosphorylation of STAT protein; positive regulation of viral genome replication; protein kinase B signaling cascade; protein tetramerization; regulation of chronic inflammatory response; regulation of insulin secretion; regulation of T cell activation; response to toxin; response to virus

Research Articles on CCL5

Similar Products

Product Notes

The CCL5 ccl5 (Catalog #AAA1272787) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggtct ccgcggcagc cctcgctgtc atcctcattg ctactgccct ctgcgctcct gcatctgcct ccccatattc ctcggacacc acaccctgct gctttgccta cattgcccgc ccactgcccc gtgcccacat caaggagtat ttctacacca gtggcaagtg ctccaaccca gcagtcgtct ttgtcacccg aaagaaccgc caagtgtgtg ccaacccaga gaagaaatgg gttcgggagt acatcaactc tttggagatg agctag. It is sometimes possible for the material contained within the vial of "CCL5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.