Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LSM1 cdna clone

LSM1 cDNA Clone

Gene Names
LSM1; CASM; YJL124C
Synonyms
LSM1; LSM1 cDNA Clone; LSM1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaactatatgcctggcaccgccagcctcatcgaggacattgacaaaaagcacttggttctgcttcgagatggaaggacacttataggctttttaagaagcattgatcaatttgcaaacttagtgctacatcagactgtggagcgtattcatgtgggcaaaaaatacggtgatattcctcgagggatttttgtggtcagaggagaaaatgtggtcctactaggagaaatagacttggaaaaggagagtgacacacccctccagcaagtatccattgaagaaattctagaagaacaaagggtggaacagcagaccaagctggaagcagagaagttgaaagtgcaggccctgaaggaccgaggtctttccattcctcgagcagatactcttgatgagtactaa
Sequence Length
402
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,179 Da
NCBI Official Full Name
Homo sapiens LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
LSM1 homolog, mRNA degradation associated
NCBI Official Symbol
LSM1
NCBI Official Synonym Symbols
CASM; YJL124C
NCBI Protein Information
U6 snRNA-associated Sm-like protein LSm1
UniProt Protein Name
U6 snRNA-associated Sm-like protein LSm1
Protein Family
UniProt Gene Name
LSM1
UniProt Synonym Gene Names
CASM
UniProt Entry Name
LSM1_HUMAN

NCBI Description

This gene encodes a member of the LSm family of RNA-binding proteins. LSm proteins form stable heteromers that bind specifically to the 3'-terminal oligo(U) tract of U6 snRNA and may play a role in pre-mRNA splicing by mediating U4/U6 snRNP formation. Increased expression of this gene may play a role in cellular transformation and the progression of several malignancies including lung cancer, mesothelioma and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Nov 2011]

Uniprot Description

LSM1: Plays a role in replication-dependent histone mRNA degradation. Binds specifically to the 3'-terminal U-tract of U6 snRNA. Belongs to the snRNP Sm proteins family.

Protein type: RNA-binding

Chromosomal Location of Human Ortholog: 8p11.2

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: protein binding; RNA cap binding

Biological Process: deadenylation-dependent decapping; RNA splicing; RNA splicing, via transesterification reactions

Research Articles on LSM1

Similar Products

Product Notes

The LSM1 lsm1 (Catalog #AAA1272771) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaactata tgcctggcac cgccagcctc atcgaggaca ttgacaaaaa gcacttggtt ctgcttcgag atggaaggac acttataggc tttttaagaa gcattgatca atttgcaaac ttagtgctac atcagactgt ggagcgtatt catgtgggca aaaaatacgg tgatattcct cgagggattt ttgtggtcag aggagaaaat gtggtcctac taggagaaat agacttggaa aaggagagtg acacacccct ccagcaagta tccattgaag aaattctaga agaacaaagg gtggaacagc agaccaagct ggaagcagag aagttgaaag tgcaggccct gaaggaccga ggtctttcca ttcctcgagc agatactctt gatgagtact aa. It is sometimes possible for the material contained within the vial of "LSM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.