Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RRAS2 cdna clone

RRAS2 cDNA Clone

Synonyms
RRAS2; RRAS2 cDNA Clone; RRAS2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgcggccggctggcgggacggctccggccaggagaagtaccggctcgtggtggtcggcgggggcggcgtgggcaagtcggcgctcaccatccagttcatccagtcctattttgtaacggattatgatccaaccattgaagattcttacacaaagcagtgtgtgatagatgacagagcagcccggctagatattttggatacagcaggacaagaagagtttggagccatgagagaacagtatatgaggactggcgaaggcttcctgttggtcttttcagtcacagatagaggcagttttgaagaaatctataagtttcaaagacagattctcagagtaaaggatcgtgatgagttcccaatgattttaattggtaataaagcagatctggatcatcaaagacaggtaacacaggaagaaggacaacagttagcacggcagcttaaggtaacatacatggaggcatcagcaaagattaggatgaatgtagatcaagctttccatgaacttgtccgggttatcaggaaatttcaagagcaggaatgtcctccttcaccagaaccaacacggaaagaaaaagacaagaaaggctgccattgtgtcattttctag
Sequence Length
615
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,196 Da
NCBI Official Full Name
Homo sapiens related RAS viral (r-ras) oncogene homolog 2, mRNA
UniProt Protein Name
Ras-related protein R-Ras2
Protein Family
UniProt Gene Name
RRAS2
UniProt Synonym Gene Names
TC21
UniProt Entry Name
RRAS2_HUMAN

Uniprot Description

RRas2: It is a plasma membrane-associated GTP-binding protein with GTPase activity. Might transduce growth inhibitory signals across the cell membrane, exerting its effect through an effector shared with the Ras proteins but in an antagonistic fashion. Defects in RRAS2 are a cause of susceptibility to ovarian cancer (OC). The term ovarian cancer defines common malignancies originating from ovarian tissue. Although many histologic types of ovarian tumors have been described, epithelial ovarian carcinoma is the most common form. Ovarian cancers are often asymptomatic and the recognized signs and symptoms, even of late-stage disease, are vague. Consequently, most patients are diagnosed with advanced disease. Belongs to the small GTPase superfamily. Ras family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Oncoprotein; G protein; Motility/polarity/chemotaxis; G protein, monomeric; G protein, monomeric, Ras

Chromosomal Location of Human Ortholog: 11p15.2

Cellular Component: focal adhesion; membrane

Molecular Function: GTPase activity; protein binding

Biological Process: osteoblast differentiation

Similar Products

Product Notes

The RRAS2 rras2 (Catalog #AAA1272761) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcgg ccggctggcg ggacggctcc ggccaggaga agtaccggct cgtggtggtc ggcgggggcg gcgtgggcaa gtcggcgctc accatccagt tcatccagtc ctattttgta acggattatg atccaaccat tgaagattct tacacaaagc agtgtgtgat agatgacaga gcagcccggc tagatatttt ggatacagca ggacaagaag agtttggagc catgagagaa cagtatatga ggactggcga aggcttcctg ttggtctttt cagtcacaga tagaggcagt tttgaagaaa tctataagtt tcaaagacag attctcagag taaaggatcg tgatgagttc ccaatgattt taattggtaa taaagcagat ctggatcatc aaagacaggt aacacaggaa gaaggacaac agttagcacg gcagcttaag gtaacataca tggaggcatc agcaaagatt aggatgaatg tagatcaagc tttccatgaa cttgtccggg ttatcaggaa atttcaagag caggaatgtc ctccttcacc agaaccaaca cggaaagaaa aagacaagaa aggctgccat tgtgtcattt tctag. It is sometimes possible for the material contained within the vial of "RRAS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.