Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STAM2 cdna clone

STAM2 cDNA Clone

Gene Names
STAM2; Hbp; STAM2A; STAM2B
Synonyms
STAM2; STAM2 cDNA Clone; STAM2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctttgttcaccgccaaccccttcgagcaagacgtggaaaaagccacgaatgagtacaacactacagaagattggagtcttattatggacatatgtgacaaagttggaagtactcctaatggagcgaaagattgcctaaaagccataatgaaaagggtaaatcataaggttccacatgttgctctgcaagcactaactcttcttggggcttgtgtggcaaactgtggaaagatatttcatttagaagtatgttcccgtgattttgcaacagaagtacgtgctgtgattaaaaataaggcacatcctaaagtatgtgaaaaactgaaatctttaatggtggagtggtcagaagaatttcagaaggaccctcagtttagtctgatatctgcaactattaaatctatgaaagaagaaggaattacttttcctccagcaggttctcagactgtctcagctgctgccaagaatggtacgtcatcgaacaaaaacaaagaggatgaagacatagctaaagctattgaattatcgctgcaagaacagaaacagcaacacacagaaacaaaatccttatatccatcttcagaaattcagttaaataataaggttgcacggaaagtgagagctttatatgattttgaagctgttgaggacaatgaactcacctttaaacatggtgaaataattattgttttggatgacagtgatgccaattggtggaaaggagaaaatcacagaggaataggacttttcccatccaattttgtaacaactaatttaaacatagagactgaggcagcggctgtggacaaattgaatgtaattgatgatgatgtggaggaaattaagaaatcagagcctgagcctgtttatatagatgaggataagatggatagagccctgcaggtacttcagagtatagatccaacagattcaaaaccagactcccaagaccttttggatttagaagatatctgccaacagatgggtccaatgatagatgaaaaacttgaagaaattgataggaagcattcagaattgtctgaattgaatgttaaagtcctggaagctctggaactatataacaaattggtgaatgaagcaccagtgtactcagtctattcaaagctccaccctccagcacattacccacctgcatcatctggggttccaatgcagacatatccagttcaatcacatggtggaaactatatgggtcagagcattcaccaagtaactgttgcccaaagctatagcctaggacccgatcaaattggtccactgagatctctgcctccaaatgtgaattcctcagtgacagcacagcctgctcaaacttcatatttaagcactggacaagacactgtttccaatcctacttatatgaaccagaactctaacctacagtcagctactggtacaactgcttacacacagcaaatggggatgtctgtggatatgtcatcttatcagaacactacttccaatttgcctcaactggcaggctttccggtgacagttccagctcatccagttgcacagcagcacacaaattaccatcagcagcctctcctttag
Sequence Length
1578
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,370 Da
NCBI Official Full Name
Homo sapiens signal transducing adaptor molecule (SH3 domain and ITAM motif) 2, mRNA
NCBI Official Synonym Full Names
signal transducing adaptor molecule 2
NCBI Official Symbol
STAM2
NCBI Official Synonym Symbols
Hbp; STAM2A; STAM2B
NCBI Protein Information
signal transducing adapter molecule 2
UniProt Protein Name
Signal transducing adapter molecule 2
UniProt Gene Name
STAM2
UniProt Synonym Gene Names
HBP; STAM-2
UniProt Entry Name
STAM2_HUMAN

NCBI Description

The protein encoded by this gene is closely related to STAM, an adaptor protein involved in the downstream signaling of cytokine receptors, both of which contain a SH3 domain and the immunoreceptor tyrosine-based activation motif (ITAM). Similar to STAM, this protein acts downstream of JAK kinases, and is phosphorylated in response to cytokine stimulation. This protein and STAM thus are thought to exhibit compensatory effects on the signaling pathway downstream of JAK kinases upon cytokine stimulation. [provided by RefSeq, Jul 2008]

Uniprot Description

STAM2: an adaptor protein involved in the downstream signaling of cytokine receptors. Contain a SH3 domain and immunoreceptor tyrosine-based activation motif (ITAM). Acts downstream of JAK kinases, and is phosphorylated in response to cytokine stimulation. May modulate the signaling pathway downstream of JAK kinases upon cytokine stimulation.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q23.3

Cellular Component: cytoplasm; cytosol; intracellular membrane-bound organelle; nucleoplasm

Molecular Function: protein binding

Biological Process: autophagy; endosome transport; negative regulation of epidermal growth factor receptor signaling pathway

Research Articles on STAM2

Similar Products

Product Notes

The STAM2 stam2 (Catalog #AAA1272584) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctttgt tcaccgccaa ccccttcgag caagacgtgg aaaaagccac gaatgagtac aacactacag aagattggag tcttattatg gacatatgtg acaaagttgg aagtactcct aatggagcga aagattgcct aaaagccata atgaaaaggg taaatcataa ggttccacat gttgctctgc aagcactaac tcttcttggg gcttgtgtgg caaactgtgg aaagatattt catttagaag tatgttcccg tgattttgca acagaagtac gtgctgtgat taaaaataag gcacatccta aagtatgtga aaaactgaaa tctttaatgg tggagtggtc agaagaattt cagaaggacc ctcagtttag tctgatatct gcaactatta aatctatgaa agaagaagga attacttttc ctccagcagg ttctcagact gtctcagctg ctgccaagaa tggtacgtca tcgaacaaaa acaaagagga tgaagacata gctaaagcta ttgaattatc gctgcaagaa cagaaacagc aacacacaga aacaaaatcc ttatatccat cttcagaaat tcagttaaat aataaggttg cacggaaagt gagagcttta tatgattttg aagctgttga ggacaatgaa ctcaccttta aacatggtga aataattatt gttttggatg acagtgatgc caattggtgg aaaggagaaa atcacagagg aataggactt ttcccatcca attttgtaac aactaattta aacatagaga ctgaggcagc ggctgtggac aaattgaatg taattgatga tgatgtggag gaaattaaga aatcagagcc tgagcctgtt tatatagatg aggataagat ggatagagcc ctgcaggtac ttcagagtat agatccaaca gattcaaaac cagactccca agaccttttg gatttagaag atatctgcca acagatgggt ccaatgatag atgaaaaact tgaagaaatt gataggaagc attcagaatt gtctgaattg aatgttaaag tcctggaagc tctggaacta tataacaaat tggtgaatga agcaccagtg tactcagtct attcaaagct ccaccctcca gcacattacc cacctgcatc atctggggtt ccaatgcaga catatccagt tcaatcacat ggtggaaact atatgggtca gagcattcac caagtaactg ttgcccaaag ctatagccta ggacccgatc aaattggtcc actgagatct ctgcctccaa atgtgaattc ctcagtgaca gcacagcctg ctcaaacttc atatttaagc actggacaag acactgtttc caatcctact tatatgaacc agaactctaa cctacagtca gctactggta caactgctta cacacagcaa atggggatgt ctgtggatat gtcatcttat cagaacacta cttccaattt gcctcaactg gcaggctttc cggtgacagt tccagctcat ccagttgcac agcagcacac aaattaccat cagcagcctc tcctttag. It is sometimes possible for the material contained within the vial of "STAM2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.