PMP2 cdna clone
PMP2 cDNA Clone
Gene Names
PMP2; P2; MP2; FABP8; M-FABP
Synonyms
PMP2; PMP2 cDNA Clone; PMP2 cdna clone
Sequence
atgagcaacaaattcctgggcacctggaaacttgtctctagtgagaactttgacgattacatgaaagctctgggtgtggggttagccaccagaaaactgggaaatttggccaaacccactgtgatcatcagcaagaaaggagatattataactatacgaactgaaagtacctttaaaaatacagaaatctccttcaagctaggccaggaatttgaagaaaccacagctgacaatagaaagaccaagagcatcgtaaccctgcagagaggatcactgaatcaagtgcagagatgggatggcaaagagacaaccataaagagaaagctagtgaatgggaaaatggtagcggaatgtaaaatgaagggcgtggtgtgcaccagaatctatgagaaggtctga
Sequence Length
399
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
14,909 Da
NCBI Official Full Name
Homo sapiens peripheral myelin protein 2, mRNA
NCBI Official Synonym Full Names
peripheral myelin protein 2
NCBI Official Symbol
PMP2
NCBI Official Synonym Symbols
P2; MP2; FABP8; M-FABP
NCBI Protein Information
myelin P2 protein
UniProt Protein Name
Myelin P2 protein
Protein Family
UniProt Gene Name
PMP2
UniProt Entry Name
MYP2_HUMAN
Uniprot Description
PMP2: May play a role in lipid transport protein in Schwann cells. May bind cholesterol. Belongs to the calycin superfamily. Fatty-acid binding protein (FABP) family.
Chromosomal Location of Human Ortholog: 8q21.3-q22.1
Molecular Function: cholesterol binding; fatty acid binding; protein binding
Research Articles on PMP2
Similar Products
Product Notes
The PMP2 pmp2 (Catalog #AAA1272560) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcaaca aattcctggg cacctggaaa cttgtctcta gtgagaactt tgacgattac atgaaagctc tgggtgtggg gttagccacc agaaaactgg gaaatttggc caaacccact gtgatcatca gcaagaaagg agatattata actatacgaa ctgaaagtac ctttaaaaat acagaaatct ccttcaagct aggccaggaa tttgaagaaa ccacagctga caatagaaag accaagagca tcgtaaccct gcagagagga tcactgaatc aagtgcagag atgggatggc aaagagacaa ccataaagag aaagctagtg aatgggaaaa tggtagcgga atgtaaaatg aagggcgtgg tgtgcaccag aatctatgag aaggtctga. It is sometimes possible for the material contained within the vial of "PMP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
