ABHD2 cdna clone
ABHD2 cDNA Clone
Gene Names
ABHD2; HS1-2; LABH2; PHPS1-2
Synonyms
ABHD2; ABHD2 cDNA Clone; ABHD2 cdna clone
Sequence
atgaatgccatgctggagactcccgaactcccagccgtgtttgatggagtgaagctggctgcagtggctgctgtgctgtacgtgatcgtccggtgtttgaacctgaagagccccacagccccacctgacctctacttccaggactcggggctctcacgctttctgctcaagtcctgtcctcttctgaccaaagaatacattccaccgttgatctgggggaaaagtggacacatccagacagccttgtatgggaagatgggaagggtgaggtcgccacatccttatgggcaccggaagttcatcactatgtctgatggagccacttctacattcgacctcttcgagcccttggctgagcactgtgttggagatgatatcaccatggtcatctgccctggaattgccaatcacagcgagaagcaatacatccgcactttcgttgactacgcccagaaaaatggctatcggtgcgccgtgctgaaccacctgggtgccctgcccaacattgaattgacctcgccacgcatgttcacctatggctgcacgtgggaatttggagccatggtgaactacatcaagaagacatatcccctgacccagctggtcgtcgtgggcttcagcctgggtggtaacattgtgtgcaaatacttgggggagactcaggcaaaccaagagaaggtcctgtgctgcgtcagcgtgtgccaggggtacagtgcactgagggcccaggaaaccttcatgcaatgggatcagtgccagcggttctacaacttcctcatggctgacaacatgaagaagatcatcctctcgcacaggcaagctctttttggagaccatgttaagaaaccccagagcctggaagacacggacttgagccggctctacacagcaacatccctgatgcagattgatgacaatgtgatgaggaagtttcacggctataactccctgaaggaatactatgaggaagaaagttgcatgcggtacctgcacaggatttatgttcctctcatgctggttaatgcagctgacgatccgttggtgcatgaaagtcttctaaccattccaaaatctctttcagagaaacgagagaacgtcatgtttgtgctgcctctgcatgggggccacttgggcttctttgagggctctgtgctgttccccgagcccctgacatggatggataagctggtggtggagtacgccaacgccatttgccaatgggagcgtaacaagttgcagtgctctgacacggagcaggtggaggccgacctggagtga
Sequence Length
1278
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,315 Da
NCBI Official Full Name
Homo sapiens abhydrolase domain containing 2, mRNA
NCBI Official Synonym Full Names
abhydrolase domain containing 2
NCBI Official Symbol
ABHD2
NCBI Official Synonym Symbols
HS1-2; LABH2; PHPS1-2
NCBI Protein Information
monoacylglycerol lipase ABHD2
UniProt Protein Name
Monoacylglycerol lipase ABHD2
Protein Family
UniProt Gene Name
ABHD2
UniProt Entry Name
ABHD2_HUMAN
NCBI Description
This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. The function of this protein has not been determined. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Uniprot Description
ABHD2: May play a role in smooth muscle cells migration. Belongs to the AB hydrolase superfamily. AB hydrolase 4 family.
Protein type: Hydrolase; Membrane protein, integral; EC 3.1.1.-; Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 15q26.1
Molecular Function: acylglycerol lipase activity; hormone binding; steroid hormone receptor activity
Biological Process: acylglycerol catabolic process; response to progesterone stimulus; sperm capacitation; steroid hormone mediated signaling
Research Articles on ABHD2
Similar Products
Product Notes
The ABHD2 abhd2 (Catalog #AAA1272558) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgcca tgctggagac tcccgaactc ccagccgtgt ttgatggagt gaagctggct gcagtggctg ctgtgctgta cgtgatcgtc cggtgtttga acctgaagag ccccacagcc ccacctgacc tctacttcca ggactcgggg ctctcacgct ttctgctcaa gtcctgtcct cttctgacca aagaatacat tccaccgttg atctggggga aaagtggaca catccagaca gccttgtatg ggaagatggg aagggtgagg tcgccacatc cttatgggca ccggaagttc atcactatgt ctgatggagc cacttctaca ttcgacctct tcgagccctt ggctgagcac tgtgttggag atgatatcac catggtcatc tgccctggaa ttgccaatca cagcgagaag caatacatcc gcactttcgt tgactacgcc cagaaaaatg gctatcggtg cgccgtgctg aaccacctgg gtgccctgcc caacattgaa ttgacctcgc cacgcatgtt cacctatggc tgcacgtggg aatttggagc catggtgaac tacatcaaga agacatatcc cctgacccag ctggtcgtcg tgggcttcag cctgggtggt aacattgtgt gcaaatactt gggggagact caggcaaacc aagagaaggt cctgtgctgc gtcagcgtgt gccaggggta cagtgcactg agggcccagg aaaccttcat gcaatgggat cagtgccagc ggttctacaa cttcctcatg gctgacaaca tgaagaagat catcctctcg cacaggcaag ctctttttgg agaccatgtt aagaaacccc agagcctgga agacacggac ttgagccggc tctacacagc aacatccctg atgcagattg atgacaatgt gatgaggaag tttcacggct ataactccct gaaggaatac tatgaggaag aaagttgcat gcggtacctg cacaggattt atgttcctct catgctggtt aatgcagctg acgatccgtt ggtgcatgaa agtcttctaa ccattccaaa atctctttca gagaaacgag agaacgtcat gtttgtgctg cctctgcatg ggggccactt gggcttcttt gagggctctg tgctgttccc cgagcccctg acatggatgg ataagctggt ggtggagtac gccaacgcca tttgccaatg ggagcgtaac aagttgcagt gctctgacac ggagcaggtg gaggccgacc tggagtga. It is sometimes possible for the material contained within the vial of "ABHD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
