KLC2 cdna clone
KLC2 cDNA Clone
Synonyms
KLC2; KLC2 cDNA Clone; KLC2 cdna clone
Sequence
atggccatgatggtgtttccgcgggaggagaagctgagccaggatgagatcgtgctgggcaccaaggctgtcatccagggactggagactctgcgtggggagcatcgtgccctgctggctcctctggttgcacctgaggccggcgaagccgagcctggctcgcaggagcgctgcatcctcctgcgtcgctccctggaagccattgagcttgggctgggggaggcccaggtgatcttggcattgtcgagccacctgggggctgtagaatcagagaagcagaagctgcgggcgcaggtgcggcgtctggtgcaggagaaccagtggctgcgtgaggagctggcggggacacagcagaagctgcagcgcagtgagcaggccgtggcccagctcgaggaggagaagcagcacttgctgttcatgagccagatccgcaagttggatgaagacgcctcccctaacgaggagaagggggacgtccccaaagacacactggatgacctgttccccaatgaggatgagcagagcccagcccctagcccaggaggaggggatgtgtctggtcagcatgggggctacgagatcccggcccggctccgcaccctgcacaacctggtgatccaatacgcctcacagggccgctacgaggtagctgtgccactctgcaagcaggcactcgaagacctggagaagacgtcaggccacgaccaccctgacgttgccaccatgctgaacatcctggcactggtctatcgggatcagaacaagtacaaggaggctgcccacctgctcaatgatgctctggccatccgggagaaaacactgggcaaggaccacccagccgtggctgcgacactaaacaacctggcagtcctgtatggcaagaggggcaagtacaaggaggctgagccattgtgcaagcgggcactggagatccgggagaaggtcctgggcaagtttcacccagatgtggccaagcagctcagcaacctggccctgctgtgccagaaccagggcaaagctgaggaggtggaatattactatcggcgggcactggagatctatgctacacgcctcgggcccgatgaccccaatgtggccaagaccaagaacaacctggcttcctgctacctgaagcagggcaagtaccaggatgcggagaccttgtacaaggagatcctcacccgcgctcatgagaaagagtttggctctgtcaatggggacaacaagcccatctggatgcacgcagaggagcgggaggaaagcaaggataagcgccgggacagcgccccctatggggaatacggcagctggtacaaggcctgtaaagtagacagccccacagtcaacaccaccctgcgcagcttgggggccctataccggcgccagggcaagctggaagccgcgcacacactagaggactgtgccagccgtaaccgcaagcagggtttggaccccgcaagccagaccaaggtggtagaactgctgaaagatggcagtggcaggcggggagaccgccgcagcagccgagacatggctgggggtgccgggcctcggtctgagtctgacctcgaggacgtgggacctacagctgagtggaatggggatggcagtggctccttgaggcgcagcggttcctttgggaaactccgggatgccctgaggcgcagcagtgagatgctggtaaagaagctgcaggggggcaccccccaggagccccctaaccccaggatgaagcgggccagttccctcaacttcctcaacaagagcgtggaagagccgacccagcctggaggcacaggtctctctgacagccgcactctcagctccagctccatggacctctcccgacgaagctccctggtgggctaa
Sequence Length
1869
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
60,047 Da
NCBI Official Full Name
Homo sapiens kinesin light chain 2, mRNA
NCBI Official Synonym Full Names
kinesin light chain 2
NCBI Official Symbol
KLC2
NCBI Protein Information
kinesin light chain 2
UniProt Protein Name
Kinesin light chain 2
Protein Family
UniProt Gene Name
KLC2
UniProt Synonym Gene Names
KLC 2
UniProt Entry Name
KLC2_HUMAN
NCBI Description
The protein encoded by this gene is a light chain of kinesin, a molecular motor responsible for moving vesicles and organelles along microtubules. Defects in this gene are a cause of spastic paraplegia, optic atrophy, and neuropathy (SPOAN) syndrome. [provided by RefSeq, Mar 2016]
Uniprot Description
KLC2: Kinesin is a microtubule-associated force-producing protein that may play a role in organelle transport. The light chain may function in coupling of cargo to the heavy chain or in the modulation of its ATPase activity. Belongs to the kinesin light chain family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Motor; Microtubule-binding
Chromosomal Location of Human Ortholog: 11q13.2
Cellular Component: cell-cell adherens junction; cytosol; kinesin complex; membrane; protein complex
Molecular Function: kinesin binding; protein binding
Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; microtubule-based movement; retrograde vesicle-mediated transport, Golgi to ER
Disease: Spastic Paraplegia, Optic Atrophy, And Neuropathy
Research Articles on KLC2
Similar Products
Product Notes
The KLC2 klc2 (Catalog #AAA1272555) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccatga tggtgtttcc gcgggaggag aagctgagcc aggatgagat cgtgctgggc accaaggctg tcatccaggg actggagact ctgcgtgggg agcatcgtgc cctgctggct cctctggttg cacctgaggc cggcgaagcc gagcctggct cgcaggagcg ctgcatcctc ctgcgtcgct ccctggaagc cattgagctt gggctggggg aggcccaggt gatcttggca ttgtcgagcc acctgggggc tgtagaatca gagaagcaga agctgcgggc gcaggtgcgg cgtctggtgc aggagaacca gtggctgcgt gaggagctgg cggggacaca gcagaagctg cagcgcagtg agcaggccgt ggcccagctc gaggaggaga agcagcactt gctgttcatg agccagatcc gcaagttgga tgaagacgcc tcccctaacg aggagaaggg ggacgtcccc aaagacacac tggatgacct gttccccaat gaggatgagc agagcccagc ccctagccca ggaggagggg atgtgtctgg tcagcatggg ggctacgaga tcccggcccg gctccgcacc ctgcacaacc tggtgatcca atacgcctca cagggccgct acgaggtagc tgtgccactc tgcaagcagg cactcgaaga cctggagaag acgtcaggcc acgaccaccc tgacgttgcc accatgctga acatcctggc actggtctat cgggatcaga acaagtacaa ggaggctgcc cacctgctca atgatgctct ggccatccgg gagaaaacac tgggcaagga ccacccagcc gtggctgcga cactaaacaa cctggcagtc ctgtatggca agaggggcaa gtacaaggag gctgagccat tgtgcaagcg ggcactggag atccgggaga aggtcctggg caagtttcac ccagatgtgg ccaagcagct cagcaacctg gccctgctgt gccagaacca gggcaaagct gaggaggtgg aatattacta tcggcgggca ctggagatct atgctacacg cctcgggccc gatgacccca atgtggccaa gaccaagaac aacctggctt cctgctacct gaagcagggc aagtaccagg atgcggagac cttgtacaag gagatcctca cccgcgctca tgagaaagag tttggctctg tcaatgggga caacaagccc atctggatgc acgcagagga gcgggaggaa agcaaggata agcgccggga cagcgccccc tatggggaat acggcagctg gtacaaggcc tgtaaagtag acagccccac agtcaacacc accctgcgca gcttgggggc cctataccgg cgccagggca agctggaagc cgcgcacaca ctagaggact gtgccagccg taaccgcaag cagggtttgg accccgcaag ccagaccaag gtggtagaac tgctgaaaga tggcagtggc aggcggggag accgccgcag cagccgagac atggctgggg gtgccgggcc tcggtctgag tctgacctcg aggacgtggg acctacagct gagtggaatg gggatggcag tggctccttg aggcgcagcg gttcctttgg gaaactccgg gatgccctga ggcgcagcag tgagatgctg gtaaagaagc tgcagggggg caccccccag gagcccccta accccaggat gaagcgggcc agttccctca acttcctcaa caagagcgtg gaagagccga cccagcctgg aggcacaggt ctctctgaca gccgcactct cagctccagc tccatggacc tctcccgacg aagctccctg gtgggctaa. It is sometimes possible for the material contained within the vial of "KLC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
