SCCPDH cdna clone
SCCPDH cDNA Clone
Gene Names
SCCPDH; NET11; CGI-49
Synonyms
SCCPDH; SCCPDH cDNA Clone; SCCPDH cdna clone
Sequence
atggcgaccgagcagaggcctttccacctggtggtgttcggcgcgtctggcttcaccggccagttcgtgaccgaggaggtggcccgggagcaggtggacccggagcggagctcccgcctgccctgggccgtggcgggccgctcccgggagaagctgcagcgggtgctggagaaggcggccctgaagctgggaagaccaacactgtcatctgaagttggaatcatcatctgtgatattgctaatccagcctcgcttgatgaaatggctaaacaggcaacagttgtcctcaattgcgtaggaccatatcggttttatggagaacctgtaataaaagcatgtattgaaaatggagccagttgtatcgacatcagtggagaacctcagtttctggaactaatgcaactgaagtatcatgagaaagctgcagacaaaggggtttatatcattggaagcagcggctttgactccattccagcagatctgggagtaatatataccagaaataaaatgaatggtactttgactgctgtggaaagtttcctgactatacattcaggacatgaggggttgagcattcatgatggtacctggaagtcagcaatttatggttttggagatcagagtaatttgagaaaactaagaaatgtatcaaatctgaaacctgtcccgctcattggtccaaaattgaagagaaggtggccaatttcttattgtcgggaactcaaaggttattccattccttttatgggatctgatgtgtctgttgtaaggaggactcaacgttacttgtatgaaaatttagaggaatcaccagttcagtatgctgcgtatgtaactgtgggaggcatcacctctgttattaagctgatgtttgcaggacttttctttttgttctttgtgaggtttggaattggaaggcaacttctcataaaattcccatggttcttctcctttggctatttttcaaaacaaggcccaacacaaaaacagattgatgctgcctcattcacgctgacattctttggtcaaggatacagccgaggcactggtacagataagaacaaaccaaatatcaaaatttgtactcaggtgaaaggaccagaggctggctatgtggctacccccatagctatggttcaggcagccatgactcttctaagtgatgcttctcatctgcctaaggcgggcggggtcttcacacctggagcagctttttccaaaacaaagttgattgacagactcaacaaacacggtattgagtttagtgttattagcagctctgaagtctaa
Sequence Length
1290
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
47,151 Da
NCBI Official Full Name
Homo sapiens saccharopine dehydrogenase (putative), mRNA
NCBI Official Synonym Full Names
saccharopine dehydrogenase (putative)
NCBI Official Symbol
SCCPDH
NCBI Official Synonym Symbols
NET11; CGI-49
NCBI Protein Information
saccharopine dehydrogenase-like oxidoreductase
UniProt Protein Name
Saccharopine dehydrogenase-like oxidoreductase
Protein Family
UniProt Gene Name
SCCPDH
UniProt Entry Name
SCPDL_HUMAN
Uniprot Description
SCCPDH: Belongs to the saccharopine dehydrogenase family.
Protein type: EC 1.5.1.9; Oxidoreductase; EC 1.-.-.-
Chromosomal Location of Human Ortholog: 1q44
Cellular Component: lipid particle; membrane; midbody; mitochondrion; nucleus
Research Articles on SCCPDH
Similar Products
Product Notes
The SCCPDH sccpdh (Catalog #AAA1272512) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaccg agcagaggcc tttccacctg gtggtgttcg gcgcgtctgg cttcaccggc cagttcgtga ccgaggaggt ggcccgggag caggtggacc cggagcggag ctcccgcctg ccctgggccg tggcgggccg ctcccgggag aagctgcagc gggtgctgga gaaggcggcc ctgaagctgg gaagaccaac actgtcatct gaagttggaa tcatcatctg tgatattgct aatccagcct cgcttgatga aatggctaaa caggcaacag ttgtcctcaa ttgcgtagga ccatatcggt tttatggaga acctgtaata aaagcatgta ttgaaaatgg agccagttgt atcgacatca gtggagaacc tcagtttctg gaactaatgc aactgaagta tcatgagaaa gctgcagaca aaggggttta tatcattgga agcagcggct ttgactccat tccagcagat ctgggagtaa tatataccag aaataaaatg aatggtactt tgactgctgt ggaaagtttc ctgactatac attcaggaca tgaggggttg agcattcatg atggtacctg gaagtcagca atttatggtt ttggagatca gagtaatttg agaaaactaa gaaatgtatc aaatctgaaa cctgtcccgc tcattggtcc aaaattgaag agaaggtggc caatttctta ttgtcgggaa ctcaaaggtt attccattcc ttttatggga tctgatgtgt ctgttgtaag gaggactcaa cgttacttgt atgaaaattt agaggaatca ccagttcagt atgctgcgta tgtaactgtg ggaggcatca cctctgttat taagctgatg tttgcaggac ttttcttttt gttctttgtg aggtttggaa ttggaaggca acttctcata aaattcccat ggttcttctc ctttggctat ttttcaaaac aaggcccaac acaaaaacag attgatgctg cctcattcac gctgacattc tttggtcaag gatacagccg aggcactggt acagataaga acaaaccaaa tatcaaaatt tgtactcagg tgaaaggacc agaggctggc tatgtggcta cccccatagc tatggttcag gcagccatga ctcttctaag tgatgcttct catctgccta aggcgggcgg ggtcttcaca cctggagcag ctttttccaa aacaaagttg attgacagac tcaacaaaca cggtattgag tttagtgtta ttagcagctc tgaagtctaa. It is sometimes possible for the material contained within the vial of "SCCPDH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
