Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

XRRA1 cdna clone

XRRA1 cDNA Clone

Synonyms
XRRA1; XRRA1 cDNA Clone; XRRA1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccctctcaggaatctacaagctggatgatgggaagccttacctgaacaactgcttcccagccagaaatctgcttcgcgtgccggaggaaggccaaggacactggttagtggttcagaaaggtaacctcaagaagaagcccaagggtttggttggagcacaagctgaacgtcgggaaagcctgaaggcgacttcttttgagttcaaggggaagaaagagtctcggcgggaaaatcaggtggaccttcctggacatatcctggaccaggcttttctgctgaagcaccactgtgtgaggaagccatcagatctgtgcaccattaatgccaaggaaaatgacttcaagcattttcattctgtgatttatatcaatgcctcagaaaacctgctgcctctagaggcatttcacacgtttccagccctaaaggaactggatctcgcatttaatggcatcaaaactatctacgtgaaatatggagactttaagttattagaattcttggacctttccttcaacagcctgactgtggaggccatctgtgatttggggattctgccacacctccgtgtcctgctcctcacaggcaatggccttacctccctgccgcccaatttggccgtcgcagaacaggaggcatctgtaacatcgctgacaagcaagaggtacatcctgaggttcccagcgctggagacactgatgctggatgacaacagactctccaaccccagttgctttgccagcctggctgggctcaggagactgaagaagttaagcttggatgaaaacaggattatcaggatcccatacctacagcaagttcagctctatgacgagtcagtagactggaatggaggcaggggaagtccccataaagagccccaattcatgctgcagtccaagccaaggatgcttgaggactcagatgagcaactggattatactgtactgcccatgaaaaaggatgttgaccggacaggggtccctccactgctgaagagcttcctccaggagcgactgggaatccacttaattcgaaggaagatagtaaagcctaagcatcatgttttgatgtctcggaaggaatcatggaaggtgaaaagcgaaatcccaaaggtgccaaagcagcctctggtgctccatcacccgcgcatgaggacaaccaagtctccctcaaaggatatgctagagccagaggcagagctggctgaagatctgcccactaccaaaagcacttctgtggagtcagagatgcccactgagaacctggaaggccattccccgtcttgccggaccttcgtgccactgcctcccatctgctccaactccactgtgcatagtgaagagaccctgtcccacctgagtgacacaactgtccgcctcagcccagagcgcccatcagatgaggactccaagagcacagagtccatcttcctgacccaggtgagtgaactgccttcctccgtcatccataaggatgatttagagttaaaggagaaagaccaaaagaaaccaccaacggcacccagagaggtgaaagggactcggaggaaactcccaactgccttccttcccagcaagtaccacggctatgaagaactgctgacagccaagcctgatccagccttcattgagccaaagggaatccagaagaatgcacaagccctgcaacaaatgctgaagcacccactcctgtgccactcctccaagcccaagctggacactcttcagaaaccctatgttcacaaagagaaacgggtgctgtcctgcaccagtggacagaacggcggctggtga
Sequence Length
1797
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,896 Da
NCBI Official Full Name
Homo sapiens X-ray radiation resistance associated 1, mRNA
NCBI Official Synonym Full Names
X-ray radiation resistance associated 1
NCBI Official Symbol
XRRA1
NCBI Protein Information
X-ray radiation resistance-associated protein 1
UniProt Protein Name
X-ray radiation resistance-associated protein 1
UniProt Gene Name
XRRA1
UniProt Entry Name
XRRA1_HUMAN

Uniprot Description

XRRA1: May be involved in the response of cells to X-ray radiation. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 11q13.4

Cellular Component: cytoplasm; nucleus

Biological Process: response to X-ray

Research Articles on XRRA1

Similar Products

Product Notes

The XRRA1 xrra1 (Catalog #AAA1272507) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctct caggaatcta caagctggat gatgggaagc cttacctgaa caactgcttc ccagccagaa atctgcttcg cgtgccggag gaaggccaag gacactggtt agtggttcag aaaggtaacc tcaagaagaa gcccaagggt ttggttggag cacaagctga acgtcgggaa agcctgaagg cgacttcttt tgagttcaag gggaagaaag agtctcggcg ggaaaatcag gtggaccttc ctggacatat cctggaccag gcttttctgc tgaagcacca ctgtgtgagg aagccatcag atctgtgcac cattaatgcc aaggaaaatg acttcaagca ttttcattct gtgatttata tcaatgcctc agaaaacctg ctgcctctag aggcatttca cacgtttcca gccctaaagg aactggatct cgcatttaat ggcatcaaaa ctatctacgt gaaatatgga gactttaagt tattagaatt cttggacctt tccttcaaca gcctgactgt ggaggccatc tgtgatttgg ggattctgcc acacctccgt gtcctgctcc tcacaggcaa tggccttacc tccctgccgc ccaatttggc cgtcgcagaa caggaggcat ctgtaacatc gctgacaagc aagaggtaca tcctgaggtt cccagcgctg gagacactga tgctggatga caacagactc tccaacccca gttgctttgc cagcctggct gggctcagga gactgaagaa gttaagcttg gatgaaaaca ggattatcag gatcccatac ctacagcaag ttcagctcta tgacgagtca gtagactgga atggaggcag gggaagtccc cataaagagc cccaattcat gctgcagtcc aagccaagga tgcttgagga ctcagatgag caactggatt atactgtact gcccatgaaa aaggatgttg accggacagg ggtccctcca ctgctgaaga gcttcctcca ggagcgactg ggaatccact taattcgaag gaagatagta aagcctaagc atcatgtttt gatgtctcgg aaggaatcat ggaaggtgaa aagcgaaatc ccaaaggtgc caaagcagcc tctggtgctc catcacccgc gcatgaggac aaccaagtct ccctcaaagg atatgctaga gccagaggca gagctggctg aagatctgcc cactaccaaa agcacttctg tggagtcaga gatgcccact gagaacctgg aaggccattc cccgtcttgc cggaccttcg tgccactgcc tcccatctgc tccaactcca ctgtgcatag tgaagagacc ctgtcccacc tgagtgacac aactgtccgc ctcagcccag agcgcccatc agatgaggac tccaagagca cagagtccat cttcctgacc caggtgagtg aactgccttc ctccgtcatc cataaggatg atttagagtt aaaggagaaa gaccaaaaga aaccaccaac ggcacccaga gaggtgaaag ggactcggag gaaactccca actgccttcc ttcccagcaa gtaccacggc tatgaagaac tgctgacagc caagcctgat ccagccttca ttgagccaaa gggaatccag aagaatgcac aagccctgca acaaatgctg aagcacccac tcctgtgcca ctcctccaag cccaagctgg acactcttca gaaaccctat gttcacaaag agaaacgggt gctgtcctgc accagtggac agaacggcgg ctggtga. It is sometimes possible for the material contained within the vial of "XRRA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.