Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EZH1 cdna clone

EZH1 cDNA Clone

Gene Names
EZH1; KMT6B
Synonyms
EZH1; EZH1 cDNA Clone; EZH1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaataccaaatccccctacctccaaatgtatcacttactggaaaagaaaagtgaaatctgaatacatgcgacttcgacaacttaaacggcttcaggcaaatatgggtgcaaaggctttgtatgtggcaaattttgcaaaggttcaagaaaaaacccagatcctcaatgaagaatggaagaagcttcgtgtccaacctgttcagtcaatgaagcctgtgagtggacacccttttctcaaaaagtgtaccatagagagcattttcccgggatttgcaagccaacatatgttaatgaggtcactgaacacagttgcattggttcccatcatgtattcctggtcccctctccaacagaactttatggtagaagatgagacggttttgtgcaatattccctacatgggagatgaagtgaaagaagaagatgagacttttattgaggagctgatcaataactatgatgggaaagtccatggtgaagaagagatgatccctggatccgttctgattagtgatgctgtttttctggagttggtcgatgccctgaatcagtactcagatgaggaggaggaagggcacaatgacacctcagatggaaagcaggatgacagcaaagaagatctgccagtaacaagaaagagaaagcgacatgctattgaaggcaacaaaaagagttccaagaaacagttcccaaatgacatgatcttcagtgcaattgcctcaatgttccctgagaatggtgtcccagatgacatgaaggagaggtatcgagaactaacagagatgtcagaccccaatgcacttccccctcagtgcacacccaacatcgatggccccaatgccaagtctgtgcagcgggagcaatctctgcactccttccacacacttttttgccggcgctgctttaaatacgactgcttccttcacccttttcatgccacccctaatgtatataaacgcaagaataaagaaatcaagattgaaccagaaccatgtggcacagactgcttccttttgctggaaggagcaaaggagtatgccatgctccacaacccccgctccaagtgctctggtcgtcgccggagaaggcaccacatagtcagtgcttcctgctccaatgcctcagcctctgctgtggctgagactaaagaaggagacagtgacagggacacaggcaatgactgggcctccagttcttcagaggctaactctcgctgtcagactcccacaaaacagaaggctagtccagccccacctcaactctgcgtagtggaagcaccctcggagcctgtggaatggactggggctgaagaatctctttttcgagtcttccatggcacctacttcaacaacttctgttcaatagccaggcttctggggaccaagacgtgcaagcaggtctttcagtttgcagtcaaagaatcacttatcctgaagctgccaacagatgagctcatgaacccctcacagaagaagaaaagaaagcacagattgtgggctgcacactgcaggaagattcagctgaagaaagataactcttccacacaagtgtacaactaccaaccctgcgaccacccagaccgcccctgtgacagcacctgcccctgcatcatgactcagaatttctgtgagaagttctgccagtgcaacccagactgtcagaatcgtttccctggctgtcgctgtaagacccagtgcaataccaagcaatgtccttgctatctggcagtgcgagaatgtgaccctgacctgtgtctcacctgtggggcctcagagcactgggactgcaaggtggtttcctgtaaaaactgcagcatccagcgtggacttaagaagcacctgctgctggccccctctgatgtggccggatggggcaccttcataaaggagtctgtgcagaagaacgaattcatttctgaatactgtggtgagctcatctctcaggatgaggctgatcgacgcggaaaggtctatgacaaatacatgtccagcttcctcttcaacctcaataatgattttgtagtggatgctactcggaaaggaaacaaaattcgatttgcaaatcattcagtgaatcccaactgttatgccaaagtggtcatggtgaatggagaccatcggattgggatctttgccaagagggcaattcaagctggcgaagagctcttctttgattacaggtacagccaagctgatgctctcaagtacgtggggatcgagagggagaccgacgtcctttag
Sequence Length
2244
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,961 Da
NCBI Official Full Name
Homo sapiens enhancer of zeste homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
enhancer of zeste 1 polycomb repressive complex 2 subunit
NCBI Official Symbol
EZH1
NCBI Official Synonym Symbols
KMT6B
NCBI Protein Information
histone-lysine N-methyltransferase EZH1
UniProt Protein Name
Histone-lysine N-methyltransferase EZH1
UniProt Gene Name
EZH1
UniProt Synonym Gene Names
KIAA0388
UniProt Entry Name
EZH1_HUMAN

NCBI Description

EZH1 is a component of a noncanonical Polycomb repressive complex-2 (PRC2) that mediates methylation of histone H3 (see MIM 602812) lys27 (H3K27) and functions in the maintenance of embryonic stem cell pluripotency and plasticity (Shen et al., 2008 [PubMed 19026780]).[supplied by OMIM, Mar 2009]

Uniprot Description

EZH1: Polycomb group (PcG) protein. Catalytic subunit of the PRC2/EED-EZH1 complex, which methylates 'Lys-27' of histone H3, leading to transcriptional repression of the affected target gene. Able to mono-, di- and trimethylate 'Lys-27' of histone H3 to form H3K27me1, H3K27me2 and H3K27me3, respectively. Required for embryonic stem cell derivation and self-renewal, suggesting that it is involved in safeguarding embryonic stem cell identity. Compared to EZH1-containing complexes, it is less abundant in embryonic stem cells, has weak methyltransferase activity and plays a less critical role in forming H3K27me3, which is required for embryonic stem cell identity and proper differentiation. Belongs to the histone-lysine methyltransferase family. EZ subfamily. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase; EC 2.1.1.43; Methyltransferase, protein lysine

Chromosomal Location of Human Ortholog: 17q21.1-q21.3

Cellular Component: ESC/E(Z) complex; nucleoplasm

Biological Process: anatomical structure morphogenesis

Research Articles on EZH1

Similar Products

Product Notes

The EZH1 ezh1 (Catalog #AAA1272386) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaatac caaatccccc tacctccaaa tgtatcactt actggaaaag aaaagtgaaa tctgaataca tgcgacttcg acaacttaaa cggcttcagg caaatatggg tgcaaaggct ttgtatgtgg caaattttgc aaaggttcaa gaaaaaaccc agatcctcaa tgaagaatgg aagaagcttc gtgtccaacc tgttcagtca atgaagcctg tgagtggaca cccttttctc aaaaagtgta ccatagagag cattttcccg ggatttgcaa gccaacatat gttaatgagg tcactgaaca cagttgcatt ggttcccatc atgtattcct ggtcccctct ccaacagaac tttatggtag aagatgagac ggttttgtgc aatattccct acatgggaga tgaagtgaaa gaagaagatg agacttttat tgaggagctg atcaataact atgatgggaa agtccatggt gaagaagaga tgatccctgg atccgttctg attagtgatg ctgtttttct ggagttggtc gatgccctga atcagtactc agatgaggag gaggaagggc acaatgacac ctcagatgga aagcaggatg acagcaaaga agatctgcca gtaacaagaa agagaaagcg acatgctatt gaaggcaaca aaaagagttc caagaaacag ttcccaaatg acatgatctt cagtgcaatt gcctcaatgt tccctgagaa tggtgtccca gatgacatga aggagaggta tcgagaacta acagagatgt cagaccccaa tgcacttccc cctcagtgca cacccaacat cgatggcccc aatgccaagt ctgtgcagcg ggagcaatct ctgcactcct tccacacact tttttgccgg cgctgcttta aatacgactg cttccttcac ccttttcatg ccacccctaa tgtatataaa cgcaagaata aagaaatcaa gattgaacca gaaccatgtg gcacagactg cttccttttg ctggaaggag caaaggagta tgccatgctc cacaaccccc gctccaagtg ctctggtcgt cgccggagaa ggcaccacat agtcagtgct tcctgctcca atgcctcagc ctctgctgtg gctgagacta aagaaggaga cagtgacagg gacacaggca atgactgggc ctccagttct tcagaggcta actctcgctg tcagactccc acaaaacaga aggctagtcc agccccacct caactctgcg tagtggaagc accctcggag cctgtggaat ggactggggc tgaagaatct ctttttcgag tcttccatgg cacctacttc aacaacttct gttcaatagc caggcttctg gggaccaaga cgtgcaagca ggtctttcag tttgcagtca aagaatcact tatcctgaag ctgccaacag atgagctcat gaacccctca cagaagaaga aaagaaagca cagattgtgg gctgcacact gcaggaagat tcagctgaag aaagataact cttccacaca agtgtacaac taccaaccct gcgaccaccc agaccgcccc tgtgacagca cctgcccctg catcatgact cagaatttct gtgagaagtt ctgccagtgc aacccagact gtcagaatcg tttccctggc tgtcgctgta agacccagtg caataccaag caatgtcctt gctatctggc agtgcgagaa tgtgaccctg acctgtgtct cacctgtggg gcctcagagc actgggactg caaggtggtt tcctgtaaaa actgcagcat ccagcgtgga cttaagaagc acctgctgct ggccccctct gatgtggccg gatggggcac cttcataaag gagtctgtgc agaagaacga attcatttct gaatactgtg gtgagctcat ctctcaggat gaggctgatc gacgcggaaa ggtctatgac aaatacatgt ccagcttcct cttcaacctc aataatgatt ttgtagtgga tgctactcgg aaaggaaaca aaattcgatt tgcaaatcat tcagtgaatc ccaactgtta tgccaaagtg gtcatggtga atggagacca tcggattggg atctttgcca agagggcaat tcaagctggc gaagagctct tctttgatta caggtacagc caagctgatg ctctcaagta cgtggggatc gagagggaga ccgacgtcct ttag. It is sometimes possible for the material contained within the vial of "EZH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.