GMPPA cdna clone
GMPPA cDNA Clone
Gene Names
GMPPA; AAMR
Synonyms
GMPPA; GMPPA cDNA Clone; GMPPA cdna clone
Sequence
atgctcaaagcggtgatcctgattggaggccctcaaaagggaactcgcttcagacctttgtcttttgaggtgcccaaaccattgtttcctgtggcaggggtccctatgatccaacaccatattgaagcctgtgcccaggtccctggaatgcaggagattctgctcattggcttctaccaacctgatgagcccctcacccagttcctagaagccgcccagcaggagtttaaccttccagtcaggtacctgcaggaatttgcccccctaggcacagggggtggtctttaccattttcgagaccagatcctggctgggagccccgaggcattcttcgtgctcaatgctgatgtctgctccgacttccccttgagtgctatgttggaagcccaccgacgccagcgtcaccctttcttactccttggcactacggctaacaggacgcaatccctcaactacggctgcatcgttgagaatccacagacacacgaggtattgcactatgtggagaaacccagcacatttatcagtgacatcatcaactgcggcatctacctcttttctcctgaagccttgaagcctcttcgggatgtcttccagcgtaatcagcaggatgggcaattggaggactcaccaggcttgtggccaggggcaggtaccatccgcctagagcaggatgtgttttcagccctggcagggcagggccagatatacgtgcatctcactgatggtatctggagtcagatcaagtccgcaggttcagccctctacgcctcccgcctctacctgagccgataccaggacactcacccagaacggctggccaagcacaccccagggggcccatggatccgagggaatgtgtacatccacccgaccgccaaggtggccccctcggctgtgctgggccccaacgtctccatcgggaagggggtgaccgtgggtgagggtgtgcggctccgggagagcatcgtcctccatggagccactttgcaggagcacacgtgtgttctgcatagcatcgtgggctgggggagcaccgtgggacgctgggcccgcgtggagggtacccccagtgaccctaaccccaacgatccccgagcccgcatggacagtgagagcctcttcaaggacgggaagctgctgcctgctatcaccatcctgggctgccgagtccggatccctgccgaggtgctcatcctgaactcgattgttctgccacacaaggagctgagccgaagcttcaccaaccagatcatcctctga
Sequence Length
1263
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,018 Da
NCBI Official Full Name
Homo sapiens GDP-mannose pyrophosphorylase A, mRNA
NCBI Official Synonym Full Names
GDP-mannose pyrophosphorylase A
NCBI Official Symbol
GMPPA
NCBI Official Synonym Symbols
AAMR
NCBI Protein Information
mannose-1-phosphate guanyltransferase alpha
UniProt Protein Name
Mannose-1-phosphate guanyltransferase alpha
Protein Family
UniProt Gene Name
GMPPA
UniProt Synonym Gene Names
GMPP-alpha
UniProt Entry Name
GMPPA_HUMAN
NCBI Description
This gene is thought to encode a GDP-mannose pyrophosphorylase. This enzyme catalyzes the reaction which converts mannose-1-phosphate and GTP to GDP-mannose which is involved in the production of N-linked oligosaccharides. [provided by RefSeq, Jul 2008]
Uniprot Description
GMPPA: This gene is thought to encode a GDP-mannose pyrophosphorylase. This enzyme catalyzes the reaction which converts mannose-1-phosphate and GTP to GDP-mannose which is involved in the production of N-linked oligosaccharides. [provided by RefSeq, Jul 2008]
Protein type: Transferase; Carbohydrate Metabolism - fructose and mannose; EC 2.7.7.13; Carbohydrate Metabolism - amino sugar and nucleotide sugar
Chromosomal Location of Human Ortholog: 2q35
Molecular Function: protein binding
Disease: Alacrima, Achalasia, And Mental Retardation Syndrome
Research Articles on GMPPA
Similar Products
Product Notes
The GMPPA gmppa (Catalog #AAA1272329) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcaaag cggtgatcct gattggaggc cctcaaaagg gaactcgctt cagacctttg tcttttgagg tgcccaaacc attgtttcct gtggcagggg tccctatgat ccaacaccat attgaagcct gtgcccaggt ccctggaatg caggagattc tgctcattgg cttctaccaa cctgatgagc ccctcaccca gttcctagaa gccgcccagc aggagtttaa ccttccagtc aggtacctgc aggaatttgc ccccctaggc acagggggtg gtctttacca ttttcgagac cagatcctgg ctgggagccc cgaggcattc ttcgtgctca atgctgatgt ctgctccgac ttccccttga gtgctatgtt ggaagcccac cgacgccagc gtcacccttt cttactcctt ggcactacgg ctaacaggac gcaatccctc aactacggct gcatcgttga gaatccacag acacacgagg tattgcacta tgtggagaaa cccagcacat ttatcagtga catcatcaac tgcggcatct acctcttttc tcctgaagcc ttgaagcctc ttcgggatgt cttccagcgt aatcagcagg atgggcaatt ggaggactca ccaggcttgt ggccaggggc aggtaccatc cgcctagagc aggatgtgtt ttcagccctg gcagggcagg gccagatata cgtgcatctc actgatggta tctggagtca gatcaagtcc gcaggttcag ccctctacgc ctcccgcctc tacctgagcc gataccagga cactcaccca gaacggctgg ccaagcacac cccagggggc ccatggatcc gagggaatgt gtacatccac ccgaccgcca aggtggcccc ctcggctgtg ctgggcccca acgtctccat cgggaagggg gtgaccgtgg gtgagggtgt gcggctccgg gagagcatcg tcctccatgg agccactttg caggagcaca cgtgtgttct gcatagcatc gtgggctggg ggagcaccgt gggacgctgg gcccgcgtgg agggtacccc cagtgaccct aaccccaacg atccccgagc ccgcatggac agtgagagcc tcttcaagga cgggaagctg ctgcctgcta tcaccatcct gggctgccga gtccggatcc ctgccgaggt gctcatcctg aactcgattg ttctgccaca caaggagctg agccgaagct tcaccaacca gatcatcctc tga. It is sometimes possible for the material contained within the vial of "GMPPA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
