Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GK5 cdna clone

GK5 cDNA Clone

Synonyms
GK5; GK5 cDNA Clone; GK5 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggggctgctcacggacccggagcagagagcgcaggagccgcggtaccccggcttcgtgctggggctggatgtgggcagttctgtgatccgctgccacgtctatgaccgggcggcgcgggtctgcggctccagcgtgcagaaggtagaaaatctttatcctcaaattggctgggtagaaattgatcctgatgttctttggattcaatttgttgccgtaataaaagaagcagtcaaagctgcaggaatacagatgaatcaaattgttggtcttggcatttcaacacagagagcaacttttattacgtggaacaagaaaacaggaaatcattttcacaactttataagttggcaagacttaagagctgttgaacttgtaaaatcttggaataattctcttcttatgaagatatttcacagttcttgccgagtgcttcactttttcactagaagtaaacgactttttacagccagtttgttcactttcacaacccagcagacttctttgagattggtctggattttacagaacttgactgaggtgcaaaaggcagttgaagaagaaaattgctgctttgggactattgatacctggttgttatataagctcacaaaaggttctgtatatgccacagatttttcaaatgctagtacaactggactttttgacccatataagatgtgttggagtgggatgattacctctctaatttcgataccactttctctcctacctcctgtgagggacacaagccacaattttggatcagtggatgaagagatatttggtgtgcctataccaatagttgccttgttaaaggtccctggatatgaccagaatatctgctatatttttgggaaggggaccattgagccagtattctatcatggaagtactttataa
Sequence Length
906
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,801 Da
NCBI Official Full Name
Homo sapiens glycerol kinase 5 (putative), mRNA
NCBI Official Synonym Full Names
glycerol kinase 5 (putative)
NCBI Official Symbol
GK5
NCBI Protein Information
putative glycerol kinase 5
UniProt Protein Name
Putative glycerol kinase 5
Protein Family
UniProt Gene Name
GK5
UniProt Synonym Gene Names
GK 5; Glycerokinase 5
UniProt Entry Name
GLPK5_HUMAN

Uniprot Description

GK5: Belongs to the FGGY kinase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Kinase, other; EC 2.7.1.30

Chromosomal Location of Human Ortholog: 3q23

Cellular Component: cytoplasm

Molecular Function: phosphotransferase activity, alcohol group as acceptor

Biological Process: phosphorylation

Research Articles on GK5

Similar Products

Product Notes

The GK5 gk5 (Catalog #AAA1272278) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggggc tgctcacgga cccggagcag agagcgcagg agccgcggta ccccggcttc gtgctggggc tggatgtggg cagttctgtg atccgctgcc acgtctatga ccgggcggcg cgggtctgcg gctccagcgt gcagaaggta gaaaatcttt atcctcaaat tggctgggta gaaattgatc ctgatgttct ttggattcaa tttgttgccg taataaaaga agcagtcaaa gctgcaggaa tacagatgaa tcaaattgtt ggtcttggca tttcaacaca gagagcaact tttattacgt ggaacaagaa aacaggaaat cattttcaca actttataag ttggcaagac ttaagagctg ttgaacttgt aaaatcttgg aataattctc ttcttatgaa gatatttcac agttcttgcc gagtgcttca ctttttcact agaagtaaac gactttttac agccagtttg ttcactttca caacccagca gacttctttg agattggtct ggattttaca gaacttgact gaggtgcaaa aggcagttga agaagaaaat tgctgctttg ggactattga tacctggttg ttatataagc tcacaaaagg ttctgtatat gccacagatt tttcaaatgc tagtacaact ggactttttg acccatataa gatgtgttgg agtgggatga ttacctctct aatttcgata ccactttctc tcctacctcc tgtgagggac acaagccaca attttggatc agtggatgaa gagatatttg gtgtgcctat accaatagtt gccttgttaa aggtccctgg atatgaccag aatatctgct atatttttgg gaaggggacc attgagccag tattctatca tggaagtact ttataa. It is sometimes possible for the material contained within the vial of "GK5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.