Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TSEN54 cdna clone

TSEN54 cDNA Clone

Gene Names
TSEN54; PCH4; PCH5; PCH2A; sen54; SEN54L
Synonyms
TSEN54; TSEN54 cDNA Clone; TSEN54 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcccgatcccgagcccgcggccgtggaggttcccgcggggcgcgtgctcagcgcccgggagctcttcgccgcccgctcgcggtcgcagaagctgccccagcgctcgcatggccccaaggactttctgcccgacggctcggcagctcaggccgagcggctgcgccggtgccgggaagagctctggcagctgctggcagagcagcgcgtggagcgcctgggcagcttggtggctgccgagtggaggccagaagagggcttcgtggagttgaagtctcccgcgggcaaattctggcagaccatgggcttctcagagcagggccggcagcgccttcacccggaagaggccttgtatcttctggagtgtggctccatccacctcttccaccaagacctgccactgtctatccaggaagcttaccagctgctgctgaccgaccacactgtgaccttcctgcagtaccaggtcttcagccacctgaagaggttgggttatgtggttcgacgattccaaccaagctctgtcctgtccccgtatgagaggcagcttaacctggatgccagcgtgcagcacttggaggatggagatggcaagagaaagaggagcagctccagccctcggtccattaataagaaggccaaggccctggacaactccctgcaacccaagagtctggcagcctccagcccacctccctgcagccagcccagccaatgcccagaggagaaaccccaggagtcaagccccatgaagggcccagggggcccctttcagcttctggggtccctgggccccagccctggcccggccagggagggggtggggtgcagctgggagagtggcagagccgagaacggagtcacgggagccggtaagcggcgctggaacttcgagcagatctccttccccaacatggcttcagacagccgccacacccttctgcgcgccccagccccagagctgctcccggccaacgtggctgggcgggagacagacgctgagtcctggtgccagaagctgaaccagcgcaaggagaacctctccaggcgggaacgggagcaccacgcggaggccgcgcagttccaggaagatgtcaacgccgatcccgaggtgcagcgctgctccagctggcgggagtacaaggagctgctgcagcggcggcaggtgcagaggagccagcgccgggcccctcacctgtggggccagcccgtcaccccgctgctgagtcctggccaggccagctccccagccgtggtccttcagcatatctctgtgctgcagacaacacaccttcctgatggaggtgtccggctgttggagaagtctgggggcttggaaatcatctttgatgtttaccaggccgacgctgtggccacattccgaaagaataaccctggcaaaccctatgcccggatgtgcattagtggatttgatgagcctgtcccagacctctgcagcctcaagcggttgtcttaccagagtggggatgtccctctgatctttgccctggtggatcatggtgacatctccttctacagcttcagggacttcacgttgccccaggatgtggggcactga
Sequence Length
1581
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,981 Da
NCBI Official Full Name
Homo sapiens tRNA splicing endonuclease 54 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
tRNA splicing endonuclease subunit 54
NCBI Official Symbol
TSEN54
NCBI Official Synonym Symbols
PCH4; PCH5; PCH2A; sen54; SEN54L
NCBI Protein Information
tRNA-splicing endonuclease subunit Sen54
UniProt Protein Name
tRNA-splicing endonuclease subunit Sen54
UniProt Gene Name
TSEN54
UniProt Synonym Gene Names
SEN54; HsSEN54
UniProt Entry Name
SEN54_HUMAN

NCBI Description

This gene encodes a subunit of the tRNA splicing endonuclease complex, which catalyzes the removal of introns from precursor tRNAs. The complex is also implicated in pre-mRNA 3-prime end processing. Mutations in this gene result in pontocerebellar hypoplasia type 2.[provided by RefSeq, Oct 2009]

Uniprot Description

TSEN54: Non-catalytic subunit of the tRNA-splicing endonuclease complex, a complex responsible for identification and cleavage of the splice sites in pre-tRNA. It cleaves pre-tRNA at the 5' and 3' splice sites to release the intron. The products are an intron and two tRNA half-molecules bearing 2',3' cyclic phosphate and 5'-OH termini. There are no conserved sequences at the splice sites, but the intron is invariably located at the same site in the gene, placing the splice sites an invariant distance from the constant structural features of the tRNA body. The tRNA splicing endonuclease is also involved in mRNA processing via its association with pre-mRNA 3' end processing factors, establishing a link between pre-tRNA splicing and pre-mRNA 3' end formation, suggesting that the endonuclease subunits function in multiple RNA-processing events. Defects in TSEN54 are the cause of pontocerebellar hypoplasia type 4 (PCH4). Pontocerebellar hypoplasia (PCH) is a heterogeneous group of disorders characterized by an abnormally small cerebellum and brainstem. PCH4 is characterized by severe course and early lethality. Defects in TSEN54 are the cause of pontocerebellar hypoplasia type 2A (PCH2A). Pontocerebellar hypoplasia (PCH) is a heterogeneous group of disorders characterized by an abnormally small cerebellum and brainstem. PCH type 2 is characterized by progressive microcephaly from birth combined with extrapyramidal dyskinesia and chorea, epilepsy, and normal spinal cord findings. Belongs to the SEN54 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleolus

Chromosomal Location of Human Ortholog: 17q25.1

Cellular Component: nucleoplasm; tRNA-intron endonuclease complex

Molecular Function: protein binding; tRNA-intron endonuclease activity

Biological Process: tRNA splicing; tRNA-type intron splice site recognition and cleavage

Disease: Pontocerebellar Hypoplasia, Type 2a; Pontocerebellar Hypoplasia, Type 4

Research Articles on TSEN54

Similar Products

Product Notes

The TSEN54 tsen54 (Catalog #AAA1272235) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcccg atcccgagcc cgcggccgtg gaggttcccg cggggcgcgt gctcagcgcc cgggagctct tcgccgcccg ctcgcggtcg cagaagctgc cccagcgctc gcatggcccc aaggactttc tgcccgacgg ctcggcagct caggccgagc ggctgcgccg gtgccgggaa gagctctggc agctgctggc agagcagcgc gtggagcgcc tgggcagctt ggtggctgcc gagtggaggc cagaagaggg cttcgtggag ttgaagtctc ccgcgggcaa attctggcag accatgggct tctcagagca gggccggcag cgccttcacc cggaagaggc cttgtatctt ctggagtgtg gctccatcca cctcttccac caagacctgc cactgtctat ccaggaagct taccagctgc tgctgaccga ccacactgtg accttcctgc agtaccaggt cttcagccac ctgaagaggt tgggttatgt ggttcgacga ttccaaccaa gctctgtcct gtccccgtat gagaggcagc ttaacctgga tgccagcgtg cagcacttgg aggatggaga tggcaagaga aagaggagca gctccagccc tcggtccatt aataagaagg ccaaggccct ggacaactcc ctgcaaccca agagtctggc agcctccagc ccacctccct gcagccagcc cagccaatgc ccagaggaga aaccccagga gtcaagcccc atgaagggcc cagggggccc ctttcagctt ctggggtccc tgggccccag ccctggcccg gccagggagg gggtggggtg cagctgggag agtggcagag ccgagaacgg agtcacggga gccggtaagc ggcgctggaa cttcgagcag atctccttcc ccaacatggc ttcagacagc cgccacaccc ttctgcgcgc cccagcccca gagctgctcc cggccaacgt ggctgggcgg gagacagacg ctgagtcctg gtgccagaag ctgaaccagc gcaaggagaa cctctccagg cgggaacggg agcaccacgc ggaggccgcg cagttccagg aagatgtcaa cgccgatccc gaggtgcagc gctgctccag ctggcgggag tacaaggagc tgctgcagcg gcggcaggtg cagaggagcc agcgccgggc ccctcacctg tggggccagc ccgtcacccc gctgctgagt cctggccagg ccagctcccc agccgtggtc cttcagcata tctctgtgct gcagacaaca caccttcctg atggaggtgt ccggctgttg gagaagtctg ggggcttgga aatcatcttt gatgtttacc aggccgacgc tgtggccaca ttccgaaaga ataaccctgg caaaccctat gcccggatgt gcattagtgg atttgatgag cctgtcccag acctctgcag cctcaagcgg ttgtcttacc agagtgggga tgtccctctg atctttgccc tggtggatca tggtgacatc tccttctaca gcttcaggga cttcacgttg ccccaggatg tggggcactg a. It is sometimes possible for the material contained within the vial of "TSEN54, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.