OLIG3 cdna clone
OLIG3 cDNA Clone
Gene Names
OLIG3; Bhlhb7; bHLHe20
Synonyms
OLIG3; OLIG3 cDNA Clone; OLIG3 cdna clone
Sequence
atgaattctgattcgagctctgtctccagcagagcttcatctccggacatggatgagatgtacctgagggaccaccaccaccgccaccaccaccaccaggagagccgtctcaactcggtctcgtccacgcagggcgatatgatgcagaagatgcccggggaaagcctctcgcgggctggcgccaaggccgcgggagagagcagcaagtacaaaatcaagaagcagctgtcggagcaggacctacagcagttgaggctgaagatcaacggacgcgaacgcaagcggatgcacgacctgaacctagccatggacgggctgcgcgaagtcatgccctacgcgcatgggccgtcggtgcgcaagctctccaagatcgccacactcctgctcgccagaaactacatcctcatgctcaccagctccctggaggagatgaagaggctggttggcgagatctatgggggccaccactcggcctttcactgcgggaccgtgggccactcggccggccaccccgcgcacgcggccaactccgtgcacccggtgcaccccatcttgggcggcgcgctctcatctggcaacgcctcgtcaccgctgtccgccgcctcacttcccgccatcggcaccatccggcctccccactcgctactcaaggcgccctccacgccgcccgcgctgcagctgggcagcggcttccagcactgggctggtctgccctgcccctgcaccatctgccagatgccgccgccgccgcacctgtccgctctctccacagccaacatggcccggctgtcggccgagtccaaggacttgctcaagtga
Sequence Length
819
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,358 Da
NCBI Official Full Name
Homo sapiens oligodendrocyte transcription factor 3, mRNA
NCBI Official Synonym Full Names
oligodendrocyte transcription factor 3
NCBI Official Symbol
OLIG3
NCBI Official Synonym Symbols
Bhlhb7; bHLHe20
NCBI Protein Information
oligodendrocyte transcription factor 3
UniProt Protein Name
Oligodendrocyte transcription factor 3
Protein Family
UniProt Gene Name
OLIG3
UniProt Synonym Gene Names
BHLHB7; BHLHE20; Oligo3; bHLHb7; bHLHe20
UniProt Entry Name
OLIG3_HUMAN
Uniprot Description
OLIG3: May determine the distinct specification program of class A neurons in the dorsal part of the spinal cord and suppress specification of class B neurons.
Chromosomal Location of Human Ortholog: 6q23.3
Molecular Function: protein binding
Research Articles on OLIG3
Similar Products
Product Notes
The OLIG3 olig3 (Catalog #AAA1272212) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaattctg attcgagctc tgtctccagc agagcttcat ctccggacat ggatgagatg tacctgaggg accaccacca ccgccaccac caccaccagg agagccgtct caactcggtc tcgtccacgc agggcgatat gatgcagaag atgcccgggg aaagcctctc gcgggctggc gccaaggccg cgggagagag cagcaagtac aaaatcaaga agcagctgtc ggagcaggac ctacagcagt tgaggctgaa gatcaacgga cgcgaacgca agcggatgca cgacctgaac ctagccatgg acgggctgcg cgaagtcatg ccctacgcgc atgggccgtc ggtgcgcaag ctctccaaga tcgccacact cctgctcgcc agaaactaca tcctcatgct caccagctcc ctggaggaga tgaagaggct ggttggcgag atctatgggg gccaccactc ggcctttcac tgcgggaccg tgggccactc ggccggccac cccgcgcacg cggccaactc cgtgcacccg gtgcacccca tcttgggcgg cgcgctctca tctggcaacg cctcgtcacc gctgtccgcc gcctcacttc ccgccatcgg caccatccgg cctccccact cgctactcaa ggcgccctcc acgccgcccg cgctgcagct gggcagcggc ttccagcact gggctggtct gccctgcccc tgcaccatct gccagatgcc gccgccgccg cacctgtccg ctctctccac agccaacatg gcccggctgt cggccgagtc caaggacttg ctcaagtga. It is sometimes possible for the material contained within the vial of "OLIG3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
