Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

ROR1 cdna clone

ROR1 cDNA Clone

Gene Names
ROR1; NTRKR1; dJ537F10.1
Synonyms
ROR1; ROR1 cDNA Clone; ROR1 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgcaccggccgcgccgccgcgggacgcgcccgccgctcctggcgctgctggccgcgctgctgctggccgcacgcggggctgctgcccaagaaacagagctgtcagtcagtgctgaattagtgcctacctcatcatggaacatctcaagtgaactcaacaaagattcttacctgacccttgatgaaccaatgaataacatcaccacgtctctgggccagacagcagaactgcactgcaaagtctctgggaatccacctcccaccatccgctggttcaaaaatgatgctcctgtggtccaggagccccggaggctctcctttcggtccaccatctatggctctcggctgcggattagaaacctcgacaccacagacacaggctacttccagtgcgtggcaacaaacggcaaggaggtggtttcttccactggagtcttgtttgtcaagtttggcccccctcccactgcaagtccaggatactcagatgagtatgaagaagatggattctgtcagccatacagagggattgcatgtgcaagatttattggcaaccgcaccgtctatatggagtctttgcacatgcaaggggaaatagaaaatcagatcacagctgccttcactatgattggcacttccagtcacttatctgataagtgttctcagttcgccattccttccctgtgccactatgccttcccgtactgcgatgaaacttcatccgtcccaaagccccgtgacttgtgtcgcgatgaatgtgaaatcctggagaatgtcctgtgtcaaacagagtacatttttgcaagatcaaatcccatgattctgatgaggctgaaactgccaaactgtgaagatctcccccagccagagagcccagaagctgcgaactgtatccggattggaattcccatggcagatcctataaataaaaatcacaagtgttataacagcacaggtgtggactaccgggggaccgtcagtgtgaccaaatcagggcgccagtgccagccatggaattcccagtatccccacacacacactttcaccgcccttcgtttcccagagctgaatggaggccattcctactgccgcaacccagggaatcaaaaggaagctccctggtgcttcaccttggatgaaaactttaagtctgatctgtgtgacatcccagcttgcggtaaatag
Sequence Length
1182
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,826 Da
NCBI Official Full Name
Homo sapiens receptor tyrosine kinase-like orphan receptor 1, mRNA
NCBI Official Synonym Full Names
receptor tyrosine kinase like orphan receptor 1
NCBI Official Symbol
ROR1
NCBI Official Synonym Symbols
NTRKR1; dJ537F10.1
NCBI Protein Information
inactive tyrosine-protein kinase transmembrane receptor ROR1
UniProt Protein Name
Inactive tyrosine-protein kinase transmembrane receptor ROR1
UniProt Gene Name
ROR1
UniProt Synonym Gene Names
NTRKR1
UniProt Entry Name
ROR1_HUMAN

NCBI Description

This gene encodes a receptor tyrosine kinase-like orphan receptor that modulates neurite growth in the central nervous system. The encoded protein is a glycosylated type I membrane protein that belongs to the ROR subfamily of cell surface receptors. It is a pseudokinase that lacks catalytic activity and may interact with the non-canonical Wnt signalling pathway. This gene is highly expressed during early embryonic development but expressed at very low levels in adult tissues. Increased expression of this gene is associated with B-cell chronic lymphocytic leukaemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2012]

Uniprot Description

ROR1: Tyrosine-protein kinase receptor whose role is not yet clear. Expressed strongly in human heart, lung and kidney, but weakly in the CNS. Isoform Short is strongly expressed in fetal and adult CNS and in a variety of human cancers, including those originating from CNS or PNS neuroectoderm. Belongs to the protein kinase superfamily. Tyr protein kinase family. ROR subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; EC 2.7.10.1; Protein kinase, TK; Kinase, protein; Protein kinase, tyrosine (receptor); TK group; Ror family

Chromosomal Location of Human Ortholog: 1p31.3

Cellular Component: cytoplasm; integral to plasma membrane; plasma membrane; receptor complex

Molecular Function: protein binding; transmembrane receptor protein tyrosine kinase activity; Wnt-protein binding

Research Articles on ROR1

Similar Products

Product Notes

The ROR1 ror1 (Catalog #AAA1272182) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaccggc cgcgccgccg cgggacgcgc ccgccgctcc tggcgctgct ggccgcgctg ctgctggccg cacgcggggc tgctgcccaa gaaacagagc tgtcagtcag tgctgaatta gtgcctacct catcatggaa catctcaagt gaactcaaca aagattctta cctgaccctt gatgaaccaa tgaataacat caccacgtct ctgggccaga cagcagaact gcactgcaaa gtctctggga atccacctcc caccatccgc tggttcaaaa atgatgctcc tgtggtccag gagccccgga ggctctcctt tcggtccacc atctatggct ctcggctgcg gattagaaac ctcgacacca cagacacagg ctacttccag tgcgtggcaa caaacggcaa ggaggtggtt tcttccactg gagtcttgtt tgtcaagttt ggcccccctc ccactgcaag tccaggatac tcagatgagt atgaagaaga tggattctgt cagccataca gagggattgc atgtgcaaga tttattggca accgcaccgt ctatatggag tctttgcaca tgcaagggga aatagaaaat cagatcacag ctgccttcac tatgattggc acttccagtc acttatctga taagtgttct cagttcgcca ttccttccct gtgccactat gccttcccgt actgcgatga aacttcatcc gtcccaaagc cccgtgactt gtgtcgcgat gaatgtgaaa tcctggagaa tgtcctgtgt caaacagagt acatttttgc aagatcaaat cccatgattc tgatgaggct gaaactgcca aactgtgaag atctccccca gccagagagc ccagaagctg cgaactgtat ccggattgga attcccatgg cagatcctat aaataaaaat cacaagtgtt ataacagcac aggtgtggac taccggggga ccgtcagtgt gaccaaatca gggcgccagt gccagccatg gaattcccag tatccccaca cacacacttt caccgccctt cgtttcccag agctgaatgg aggccattcc tactgccgca acccagggaa tcaaaaggaa gctccctggt gcttcacctt ggatgaaaac tttaagtctg atctgtgtga catcccagct tgcggtaaat ag. It is sometimes possible for the material contained within the vial of "ROR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual