Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACAD10 cdna clone

ACAD10 cDNA Clone

Synonyms
ACAD10; ACAD10 cDNA Clone; ACAD10 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgtgtcaggagctgtttccagtccccccgtctccagtgggtgtggagaacagccttcctgaaacacacccagcgcaggcaccaggggtcccaccgatggacacaccttggaggcagcacctacagagcggtgattttcgacatgggcggagttctcattccttctccagggagagtcgctgcagaatgggaggtacagaatcgtatcccttctggaactatattaaaggccttgatggaaggtggtgaaaatgggccctggatgagatttatgagagcagaaataacagcagagggttttttacgagaatttgggagactttgctctgaaatgttaaagacctccgtgcctgtggactcatttttctctctgttgaccagtgagcgagtggcaaagcagttcccagtgatgactgaggccataactcaaattcgggcaaaaggtcttcagactgcagtcttgagcaataatttttatcttcccaaccagaaaagctttttgcccctggaccggaaacagtttgatgtgattgtggagtcctgcatggaagggatctgtaagccagaccctaggatctacaagctgtgcttggagcagctcggcctgcagccctctgagtccatctttcttgatgaccttggaacaaatctaaaagaagctgccagacttggtattcacaccattaaggttaatgacccagagactgcagtaaaggaattagaagctctcttgggttttacattgagagtaggtgttccaaacactcggcctgtgaaaaagacgatggaaattccgaaagattccttgcagaagtacctcaaagacttactgggtatccagaccacaggcccattggaactacttcagtttgatcacgggcagtcaaatccaacttactacatcaggctggctaatcgtgatctagttctgaggaagaagcccccagggacactccttccatctgcccatgccatagagagggagttcaggattatgaaagcccttgcaaatgctggagtacctgtccctaacgttcttgatctctgtgaagattcaagtgtcattggcacccccttctatgtgatggagtactgcccaggtctcatctacaaagacccttccctgccaggcttggagcccagccacagacgagccatatacactgccatgaacacagtcctgtgcaaaattcacagtgtggatctgcaggctgtgggacttgaagactatgggaagcaaggggactatattccacgccaggtacgaacctgggttaagcagtatcgagcttccgaaactagcaccatcccagccatggagaggctgatcgaatggctgcccctccatcttccccgtcagcagaggaccacagtggtgcacggggacttcaggctcgacaacctggtgtttcatccagaagagccagaggtgcttgctgtccttgactgggaactttctaccttgggcgacccccttgctgatgtggcctacagctgcctggctcattacctgccatccagttttcccgtgctgagaggtattaatgactgtgacttgacacagctgggaatccctgctgcagaggagtatttcaggatgtactgtctccaaatggggctccctcccactgagaactggaacttctatatggctttttcctttttccgtgtggctgcaatcctacagggagtctacaagcgatcactcacagggcaagcaagctccacatatgcggaacaaactggaaagctgaccgaatttgtgtctaacctggcgtgggatttcgcagtcaaagaagggttccgggttttcaaagagatgcccttcacaaatccgttaacaaggtcctaccacacgtgggccaggccccagtcccagtggtgccccacaggcagcaggagttatagctccgttccagaagcttccccagctcatacctcaaggggaggtctggttatctctccagagagcctctctccacctgtcagagagctgtatcaccggctgaagcacttcatggagcaacgtgtgtaccctgcagagccagagctgcagagtcaccaggcctcagcagccaggtggagcccctccccactgatcgaagacctcaaggagaaagccaaagctgaaggactttggaaccttttcctacccttagaggctgatcccgagaaaaaatacggagcaggactgaccaatgtggaatatgcacatctgtgtgagctcatgggcacgtccctgtatgcccccgaggtatgtaactgctctgcgcctgacacgggcaacatggagctgctggtgaggtatggcaccgaagcgcagaaggctcgctggctgattcctctgctggaggggaaagcccgctcctgttttgctatgaccgagccccaggttgcctcttcagatgccaccaacattgaggcttccatcagagaggaggacagcttctatgtcataaacggtcacaaatggtggatcacaggcatcctggatcctcgttgccaactctgtgtgtttatgggaaaaacagacccacatgcaccaagacaccggcagcagtctgtgctcttggttcccatggataccccagggataaaaatcatccggcctctgacggtgtatggactggaagatgcaccaggtggccatggtgaagtccgatttgagcacgtgcgtgtgcccaaagagaacatggtcctgggccctggccgaggctttgagatcgcccagggcagactgggccccggcaggatccatcactgcatgaggctgatcgggttctcagagagggccctggcactcatgaaggcccgcgtgaagtcccgcttggcttttgggaagcccctggtggagcagggcacagtgctggcggacatcgcgcagtcgcgcgtggagattgagcaggcacggctgctggtgctgagagctgcccacctcatggacctggcaggaaacaaggctgcagccttggatatagccatgattaaaatggtcgccccgtccatggcctcccgagtgattgatcgtgcgattcaggcctttggagcagcaggcctgagcagcgactacccactggctcagttcttcacctgggcccgagccctgcgctttgccgacggccctgacgaggtgcaccgggccacggtggccaagctagagctgaagcaccgcatttag
Sequence Length
3180
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
122,340 Da
NCBI Official Full Name
Homo sapiens acyl-Coenzyme A dehydrogenase family, member 10, mRNA
NCBI Official Synonym Full Names
acyl-CoA dehydrogenase family member 10
NCBI Official Symbol
ACAD10
NCBI Protein Information
acyl-CoA dehydrogenase family member 10
UniProt Protein Name
Acyl-CoA dehydrogenase family member 10
UniProt Gene Name
ACAD10
UniProt Synonym Gene Names
ACAD-10
UniProt Entry Name
ACD10_HUMAN

NCBI Description

This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]

Uniprot Description

ACAD10: Acyl-CoA dehydrogenase only active with R- and S-2- methyl-C15-CoA. Belongs to the acyl-CoA dehydrogenase family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Oxidoreductase; Mitochondrial; EC 1.3.99.-

Chromosomal Location of Human Ortholog: 12q24.12

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: acyl-CoA binding; acyl-CoA dehydrogenase activity; electron carrier activity; FAD binding

Biological Process: fatty acid beta-oxidation; fatty acid beta-oxidation using acyl-CoA dehydrogenase; lipid homeostasis

Research Articles on ACAD10

Similar Products

Product Notes

The ACAD10 acad10 (Catalog #AAA1272162) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtgtca ggagctgttt ccagtccccc cgtctccagt gggtgtggag aacagccttc ctgaaacaca cccagcgcag gcaccagggg tcccaccgat ggacacacct tggaggcagc acctacagag cggtgatttt cgacatgggc ggagttctca ttccttctcc agggagagtc gctgcagaat gggaggtaca gaatcgtatc ccttctggaa ctatattaaa ggccttgatg gaaggtggtg aaaatgggcc ctggatgaga tttatgagag cagaaataac agcagagggt tttttacgag aatttgggag actttgctct gaaatgttaa agacctccgt gcctgtggac tcatttttct ctctgttgac cagtgagcga gtggcaaagc agttcccagt gatgactgag gccataactc aaattcgggc aaaaggtctt cagactgcag tcttgagcaa taatttttat cttcccaacc agaaaagctt tttgcccctg gaccggaaac agtttgatgt gattgtggag tcctgcatgg aagggatctg taagccagac cctaggatct acaagctgtg cttggagcag ctcggcctgc agccctctga gtccatcttt cttgatgacc ttggaacaaa tctaaaagaa gctgccagac ttggtattca caccattaag gttaatgacc cagagactgc agtaaaggaa ttagaagctc tcttgggttt tacattgaga gtaggtgttc caaacactcg gcctgtgaaa aagacgatgg aaattccgaa agattccttg cagaagtacc tcaaagactt actgggtatc cagaccacag gcccattgga actacttcag tttgatcacg ggcagtcaaa tccaacttac tacatcaggc tggctaatcg tgatctagtt ctgaggaaga agcccccagg gacactcctt ccatctgccc atgccataga gagggagttc aggattatga aagcccttgc aaatgctgga gtacctgtcc ctaacgttct tgatctctgt gaagattcaa gtgtcattgg cacccccttc tatgtgatgg agtactgccc aggtctcatc tacaaagacc cttccctgcc aggcttggag cccagccaca gacgagccat atacactgcc atgaacacag tcctgtgcaa aattcacagt gtggatctgc aggctgtggg acttgaagac tatgggaagc aaggggacta tattccacgc caggtacgaa cctgggttaa gcagtatcga gcttccgaaa ctagcaccat cccagccatg gagaggctga tcgaatggct gcccctccat cttccccgtc agcagaggac cacagtggtg cacggggact tcaggctcga caacctggtg tttcatccag aagagccaga ggtgcttgct gtccttgact gggaactttc taccttgggc gacccccttg ctgatgtggc ctacagctgc ctggctcatt acctgccatc cagttttccc gtgctgagag gtattaatga ctgtgacttg acacagctgg gaatccctgc tgcagaggag tatttcagga tgtactgtct ccaaatgggg ctccctccca ctgagaactg gaacttctat atggcttttt cctttttccg tgtggctgca atcctacagg gagtctacaa gcgatcactc acagggcaag caagctccac atatgcggaa caaactggaa agctgaccga atttgtgtct aacctggcgt gggatttcgc agtcaaagaa gggttccggg ttttcaaaga gatgcccttc acaaatccgt taacaaggtc ctaccacacg tgggccaggc cccagtccca gtggtgcccc acaggcagca ggagttatag ctccgttcca gaagcttccc cagctcatac ctcaagggga ggtctggtta tctctccaga gagcctctct ccacctgtca gagagctgta tcaccggctg aagcacttca tggagcaacg tgtgtaccct gcagagccag agctgcagag tcaccaggcc tcagcagcca ggtggagccc ctccccactg atcgaagacc tcaaggagaa agccaaagct gaaggacttt ggaacctttt cctaccctta gaggctgatc ccgagaaaaa atacggagca ggactgacca atgtggaata tgcacatctg tgtgagctca tgggcacgtc cctgtatgcc cccgaggtat gtaactgctc tgcgcctgac acgggcaaca tggagctgct ggtgaggtat ggcaccgaag cgcagaaggc tcgctggctg attcctctgc tggaggggaa agcccgctcc tgttttgcta tgaccgagcc ccaggttgcc tcttcagatg ccaccaacat tgaggcttcc atcagagagg aggacagctt ctatgtcata aacggtcaca aatggtggat cacaggcatc ctggatcctc gttgccaact ctgtgtgttt atgggaaaaa cagacccaca tgcaccaaga caccggcagc agtctgtgct cttggttccc atggataccc cagggataaa aatcatccgg cctctgacgg tgtatggact ggaagatgca ccaggtggcc atggtgaagt ccgatttgag cacgtgcgtg tgcccaaaga gaacatggtc ctgggccctg gccgaggctt tgagatcgcc cagggcagac tgggccccgg caggatccat cactgcatga ggctgatcgg gttctcagag agggccctgg cactcatgaa ggcccgcgtg aagtcccgct tggcttttgg gaagcccctg gtggagcagg gcacagtgct ggcggacatc gcgcagtcgc gcgtggagat tgagcaggca cggctgctgg tgctgagagc tgcccacctc atggacctgg caggaaacaa ggctgcagcc ttggatatag ccatgattaa aatggtcgcc ccgtccatgg cctcccgagt gattgatcgt gcgattcagg cctttggagc agcaggcctg agcagcgact acccactggc tcagttcttc acctgggccc gagccctgcg ctttgccgac ggccctgacg aggtgcaccg ggccacggtg gccaagctag agctgaagca ccgcatttag. It is sometimes possible for the material contained within the vial of "ACAD10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.