Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FCGR3A cdna clone

FCGR3A cDNA Clone

Gene Names
FCGR3A; CD16; FCG3; CD16A; FCGR3; IGFR3; IMD20; FCR-10; FCRIII; FCGRIII; FCRIIIA
Synonyms
FCGR3A; FCGR3A cDNA Clone; FCGR3A cdna clone
Ordering
For Research Use Only!
Sequence
atgggtggaggggctggggaaaggctgtttacttcctcctgtctagtcggtttggtccctttagggctccggatatctttggtgacttgtcctctccagtgtggcatcatgtggcagctgctcctcccaactgctctgctacttctagtttcagctggcatgcggactgaagatctcccaaaggctgtggtgttcctggagcctcaatggtacagggtgctcgagaaggacagtgtgactctgaagtgccagggagcctactcccctgaggacaattccacacagtggtttcacaatgagagcctcatctcaagccaggcctcgagctacttcattgacgctgccacagtcgacgacagtggagagtacaggtgccagacaaacctctccaccctcagtgacccggtgcagctagaagtccatatcggctggctgttgctccaggcccctcggtgggtgttcaaggaggaagaccctattcacctgaggtgtcacagctggaagaacactgctctgcataaggtcacatatttacagaatggcaaaggcaggaagtattttcatcataattctgacttctacattccaaaagccacactcaaagacagcggctcctacttctgcagggggcttgttgggagtaaaaatgtgtcttcagagactgtgaacatcaccatcactcaaggtttggcagtgtcaaccatctcatcattctttccacctgggtaccaagtctctttctgcttggtgatggtactcctttttgcagtggacacaggactatatttctctgtgaagacaaacattcgaagctcaacaagagactggaaggaccataaatttaaatggagaaaggaccctcaagacaaatga
Sequence Length
873
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,089 Da
NCBI Official Full Name
Homo sapiens Fc fragment of IgG, low affinity IIIa, receptor (CD16a), mRNA
NCBI Official Synonym Full Names
Fc fragment of IgG receptor IIIa
NCBI Official Symbol
FCGR3A
NCBI Official Synonym Symbols
CD16; FCG3; CD16A; FCGR3; IGFR3; IMD20; FCR-10; FCRIII; FCGRIII; FCRIIIA
NCBI Protein Information
low affinity immunoglobulin gamma Fc region receptor III-A
UniProt Protein Name
Low affinity immunoglobulin gamma Fc region receptor III-A
UniProt Gene Name
FCGR3A
UniProt Synonym Gene Names
CD16A; FCG3; FCGR3; IGFR3; Fc-gamma RIII; Fc-gamma RIIIa; FcRIII; FcRIIIa
UniProt Entry Name
FCG3A_HUMAN

NCBI Description

This gene encodes a receptor for the Fc portion of immunoglobulin G, and it is involved in the removal of antigen-antibody complexes from the circulation, as well as other other antibody-dependent responses. This gene (FCGR3A) is highly similar to another nearby gene (FCGR3B) located on chromosome 1. The receptor encoded by this gene is expressed on natural killer (NK) cells as an integral membrane glycoprotein anchored through a transmembrane peptide, whereas FCGR3B is expressed on polymorphonuclear neutrophils (PMN) where the receptor is anchored through a phosphatidylinositol (PI) linkage. Mutations in this gene have been linked to susceptibility to recurrent viral infections, susceptibility to systemic lupus erythematosus, and alloimmune neonatal neutropenia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

FCGR3A: Receptor for the Fc region of IgG. Binds complexed or aggregated IgG and also monomeric IgG. Mediates antibody-dependent cellular cytotoxicity (ADCC) and other antibody-dependent responses, such as phagocytosis.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q23

Cellular Component: external side of plasma membrane; plasma membrane

Biological Process: immune response; regulation of immune response

Disease: Immunodeficiency 20

Research Articles on FCGR3A

Similar Products

Product Notes

The FCGR3A fcgr3a (Catalog #AAA1272151) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtggag gggctgggga aaggctgttt acttcctcct gtctagtcgg tttggtccct ttagggctcc ggatatcttt ggtgacttgt cctctccagt gtggcatcat gtggcagctg ctcctcccaa ctgctctgct acttctagtt tcagctggca tgcggactga agatctccca aaggctgtgg tgttcctgga gcctcaatgg tacagggtgc tcgagaagga cagtgtgact ctgaagtgcc agggagccta ctcccctgag gacaattcca cacagtggtt tcacaatgag agcctcatct caagccaggc ctcgagctac ttcattgacg ctgccacagt cgacgacagt ggagagtaca ggtgccagac aaacctctcc accctcagtg acccggtgca gctagaagtc catatcggct ggctgttgct ccaggcccct cggtgggtgt tcaaggagga agaccctatt cacctgaggt gtcacagctg gaagaacact gctctgcata aggtcacata tttacagaat ggcaaaggca ggaagtattt tcatcataat tctgacttct acattccaaa agccacactc aaagacagcg gctcctactt ctgcaggggg cttgttggga gtaaaaatgt gtcttcagag actgtgaaca tcaccatcac tcaaggtttg gcagtgtcaa ccatctcatc attctttcca cctgggtacc aagtctcttt ctgcttggtg atggtactcc tttttgcagt ggacacagga ctatatttct ctgtgaagac aaacattcga agctcaacaa gagactggaa ggaccataaa tttaaatgga gaaaggaccc tcaagacaaa tga. It is sometimes possible for the material contained within the vial of "FCGR3A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.