PLCD4 cdna clone
PLCD4 cDNA Clone
Synonyms
PLCD4; PLCD4 cDNA Clone; PLCD4 cdna clone
Sequence
atggcgtccctgctgcaagaccagctgaccactgatcaggacttgctgctgatgcaggaaggcatgccgatgcgcaaggtgaggtccaaaagctggaagaagctaagatacttcagacttcagaatgacggcatgacagtctggcatgcacggcaggccaggggcagtgccaagcccagcttctcaatctctgatgtggagacaatacgtaatggccatgattccgagttgctgcgtagcctggcagaggagctccccctggagcagggcttcaccattgtcttccatggccgccgctccaacctggacctgatggccaacagtgttgaggaggcccagatatggatgcgagggctccagctgttggtggatcttgtcaccagcatggaccatcaggagcgcctggaccaatggctgagcgattggtttcaacgtggagacaaaaatcaggatggtaagatgagtttccaagaagttcagcggttattgcacctaatgaatgtggaaatggaccaagaatatgccttcagtctttttcaggcagcagacacgtcccagtctggaaccctggaaggagaagaattcgtacagttctataaggcattgactaaacgtgctgaggtgcaggaactgtttgaaagtttttcagctgatgggcagaagctgactctgctggaatttttggatttcctccaagaggagcagaaggagagagactgcacctctgagcttgctctggaactcattgaccgctatgaaccttcagacagtggcaaactgcggcatgtgctgagtatggatggcttcctcagctacctctgctctaaggatggagacatcttcaacccagcctgcctccccatctatcaggatatgactcaacccctgaaccactacttcatctgctcttctcataacacctacctagtgggggaccagctttgcggccagagcagcgtcgagggatatatacgggccctgaagcgggggtgccgctgcgtggaggtggatgtatgggatggacctagcggggaacctgtcgtttaccacggacacaccctgacctcccgcatcctgttcaaagatgtcgtggccacagtagcacagtatgccttccagacatcagactacccagtcatcttgtccctggagacccactgcagctgggagcagcagcagaccatggcccgtcatctgactgagatcctgggggagcagctgctgagcaccaccttggatggggtgctgcccactcagctgccctcgcctgaggagcttcggaggaagatcctggtgaaggggaagaagttaacacttgaggaagacctggaatatgaggaagaggaagcagaacctgagttggaagagtcagaattggcgctggagtcccagtttgagactgagcctgagccccaggagcagaaccttcagaataaggacaaaaagaagaaatccaagcccatcttgtgtccagccctctcttccctggttatctacttgaagtctgtctcattccgcagcttcacacattcaaaggagcactaccacttctacgagatatcatctttctctgaaaccaaggccaagcgcctcatcaaggaggctggcaatgagtttgtgcagcacaatacttggcagttaagccgtgtgtatcccagcggcctgaggacagactcttccaactacaacccccaggaactctggaatgcaggctgccagatggtggccatgaatatgcagactgcagggcttgaaatggacatctgtgatgggcatttccgccagaatggcggctgtggctatgtgctgaagccagacttcctgcgtgatatccagagttctttccaccctgagaagcccatcagccctttcaaagcccagactctcttaatccaggtgatcagcggtcagcaactccccaaagtggacaagaccaaagaggggtccattgtggatccactggtgaaagtgcagatctttggcgttcgtctagacacagcacggcaggagaccaactatgtggagaacaatggttttaatccatactgggggcagacactatgtttccgggtgctggtgcctgaacttgccatgctgcgttttgtggtaatggattatgactggaaatcccgaaatgactttattggtcagtacaccctgccttggacctgcatgcaacaaggttaccgccacattcacctgctgtccaaagatggcatcagcctccgcccagcttccatctttgtgtatatctgcatccaggaaggcctggagggggatgagtcctga
Sequence Length
2289
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,448 Da
NCBI Official Full Name
Homo sapiens phospholipase C, delta 4, mRNA
NCBI Official Synonym Full Names
phospholipase C delta 4
NCBI Official Symbol
PLCD4
NCBI Protein Information
1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase delta-4
UniProt Protein Name
1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase delta-4
Protein Family
UniProt Gene Name
PLCD4
UniProt Synonym Gene Names
hPLCD4; PLC-delta-4
UniProt Entry Name
PLCD4_HUMAN
NCBI Description
This gene encodes a member of the delta class of phospholipase C enzymes. Phospholipase C enzymes play a critical role in many cellular processes by hydrolyzing phosphatidylinositol 4,5-bisphosphate into two intracellular second messengers, inositol 1,4,5-trisphosphate and diacylglycerol. Expression of this gene may be a marker for cancer. [provided by RefSeq, Jan 2011]
Uniprot Description
PLCD4: Hydrolyzes the phosphatidylinositol 4,5-bisphosphate (PIP2) to generate 2 second messenger molecules diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3). DAG mediates the activation of protein kinase C (PKC), while IP3 releases Ca(2+) from intracellular stores. Required for acrosome reaction in sperm during fertilization, probably by acting as an important enzyme for intracellular Ca(2+) mobilization in the zona pellucida- induced acrosome reaction. May play a role in cell growth. Modulates the liver regeneration in cooperation with nuclear PKC. Overexpression up-regulates the Erk signaling pathway and proliferation. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 3.1.4.11; Phospholipase; Carbohydrate Metabolism - inositol phosphate
Chromosomal Location of Human Ortholog: 2q35
Cellular Component: cytoplasm; nuclear membrane; plasma membrane
Research Articles on PLCD4
Similar Products
Product Notes
The PLCD4 plcd4 (Catalog #AAA1272140) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtccc tgctgcaaga ccagctgacc actgatcagg acttgctgct gatgcaggaa ggcatgccga tgcgcaaggt gaggtccaaa agctggaaga agctaagata cttcagactt cagaatgacg gcatgacagt ctggcatgca cggcaggcca ggggcagtgc caagcccagc ttctcaatct ctgatgtgga gacaatacgt aatggccatg attccgagtt gctgcgtagc ctggcagagg agctccccct ggagcagggc ttcaccattg tcttccatgg ccgccgctcc aacctggacc tgatggccaa cagtgttgag gaggcccaga tatggatgcg agggctccag ctgttggtgg atcttgtcac cagcatggac catcaggagc gcctggacca atggctgagc gattggtttc aacgtggaga caaaaatcag gatggtaaga tgagtttcca agaagttcag cggttattgc acctaatgaa tgtggaaatg gaccaagaat atgccttcag tctttttcag gcagcagaca cgtcccagtc tggaaccctg gaaggagaag aattcgtaca gttctataag gcattgacta aacgtgctga ggtgcaggaa ctgtttgaaa gtttttcagc tgatgggcag aagctgactc tgctggaatt tttggatttc ctccaagagg agcagaagga gagagactgc acctctgagc ttgctctgga actcattgac cgctatgaac cttcagacag tggcaaactg cggcatgtgc tgagtatgga tggcttcctc agctacctct gctctaagga tggagacatc ttcaacccag cctgcctccc catctatcag gatatgactc aacccctgaa ccactacttc atctgctctt ctcataacac ctacctagtg ggggaccagc tttgcggcca gagcagcgtc gagggatata tacgggccct gaagcggggg tgccgctgcg tggaggtgga tgtatgggat ggacctagcg gggaacctgt cgtttaccac ggacacaccc tgacctcccg catcctgttc aaagatgtcg tggccacagt agcacagtat gccttccaga catcagacta cccagtcatc ttgtccctgg agacccactg cagctgggag cagcagcaga ccatggcccg tcatctgact gagatcctgg gggagcagct gctgagcacc accttggatg gggtgctgcc cactcagctg ccctcgcctg aggagcttcg gaggaagatc ctggtgaagg ggaagaagtt aacacttgag gaagacctgg aatatgagga agaggaagca gaacctgagt tggaagagtc agaattggcg ctggagtccc agtttgagac tgagcctgag ccccaggagc agaaccttca gaataaggac aaaaagaaga aatccaagcc catcttgtgt ccagccctct cttccctggt tatctacttg aagtctgtct cattccgcag cttcacacat tcaaaggagc actaccactt ctacgagata tcatctttct ctgaaaccaa ggccaagcgc ctcatcaagg aggctggcaa tgagtttgtg cagcacaata cttggcagtt aagccgtgtg tatcccagcg gcctgaggac agactcttcc aactacaacc cccaggaact ctggaatgca ggctgccaga tggtggccat gaatatgcag actgcagggc ttgaaatgga catctgtgat gggcatttcc gccagaatgg cggctgtggc tatgtgctga agccagactt cctgcgtgat atccagagtt ctttccaccc tgagaagccc atcagccctt tcaaagccca gactctctta atccaggtga tcagcggtca gcaactcccc aaagtggaca agaccaaaga ggggtccatt gtggatccac tggtgaaagt gcagatcttt ggcgttcgtc tagacacagc acggcaggag accaactatg tggagaacaa tggttttaat ccatactggg ggcagacact atgtttccgg gtgctggtgc ctgaacttgc catgctgcgt tttgtggtaa tggattatga ctggaaatcc cgaaatgact ttattggtca gtacaccctg ccttggacct gcatgcaaca aggttaccgc cacattcacc tgctgtccaa agatggcatc agcctccgcc cagcttccat ctttgtgtat atctgcatcc aggaaggcct ggagggggat gagtcctga. It is sometimes possible for the material contained within the vial of "PLCD4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
