C9orf100 cdna clone
C9orf100 cDNA Clone
Gene Names
ARHGEF39; C9orf100
Synonyms
C9orf100; C9orf100 cDNA Clone; C9orf100 cdna clone
Sequence
atggagctctcctgccccggttcgcggtgcccggtgcaagagcagcgtgcccgctgggagcggaaacgcgcctgcaccgcccgggagctgctagagaccgagcggcgctaccaagaacagctggggctggtggccacgtactttttggggatcctgaaagccaaggggaccctgcgaccacctgagcgccaggccctgtttggctcctgggagctcatctacggcgccagccaggagctgcttccctacctggaaggaggatgctggggccaagggctggagggcttctgccgccacttggagctctataaccaatttgctgccaactcagagaggtcccagaccaccctgcaggagcagctaaagaaaaataaaggtttccggaggtttgtacggcttcaggaaggccgccctgagtttgggggccttcagctccaggacctgctccctctgcctctgcaacggctccagcagtatgagaatctcgtcgtagctttggctgaaaacacaggtcccaacagccctgaccatcaacagctcacacgggctgcccgactgataagtgagactgcccagagagtccatactattggtcagaaacagaagaatgaccagcaccttcggcgtgtccaggctctgctcagtggacgccaggcaaaggggctgacctcagggcgctggttcctacgccagggctggctgttagtggtgcctccccatggggagcctcggccccgcatgttcttcctcttcactgatgtgctcctcatggccaagcctcggcctccactgcacctgctgcggagtggcacctttgcctgcaaggccctctaccccatggcccagtgtcatctcagcagggtctttggccactcaggaggcccttgtggtgggttgctcagtctgtccttccctcatgagaagctactgcttatgtccacagaccaggaggagctgtcacgctggtaccacagtctgacttgggctatcagcagccagaaaaactag
Sequence Length
1008
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,647 Da
NCBI Official Full Name
Homo sapiens chromosome 9 open reading frame 100, mRNA
NCBI Official Synonym Full Names
Rho guanine nucleotide exchange factor 39
NCBI Official Symbol
ARHGEF39
NCBI Official Synonym Symbols
C9orf100
NCBI Protein Information
rho guanine nucleotide exchange factor 39
UniProt Protein Name
Rho guanine nucleotide exchange factor 39
UniProt Gene Name
ARHGEF39
UniProt Synonym Gene Names
C9orf100
UniProt Entry Name
ARG39_HUMAN
Uniprot Description
ARHGEF39: Guanine nucleotide exchange factor. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: GEFs; GEFs, Rac/Rho
Chromosomal Location of Human Ortholog: 9p13.3
Cellular Component: plasma membrane
Molecular Function: protein binding
Biological Process: positive regulation of cell migration
Research Articles on C9orf100
Similar Products
Product Notes
The C9orf100 arhgef39 (Catalog #AAA1272102) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctct cctgccccgg ttcgcggtgc ccggtgcaag agcagcgtgc ccgctgggag cggaaacgcg cctgcaccgc ccgggagctg ctagagaccg agcggcgcta ccaagaacag ctggggctgg tggccacgta ctttttgggg atcctgaaag ccaaggggac cctgcgacca cctgagcgcc aggccctgtt tggctcctgg gagctcatct acggcgccag ccaggagctg cttccctacc tggaaggagg atgctggggc caagggctgg agggcttctg ccgccacttg gagctctata accaatttgc tgccaactca gagaggtccc agaccaccct gcaggagcag ctaaagaaaa ataaaggttt ccggaggttt gtacggcttc aggaaggccg ccctgagttt gggggccttc agctccagga cctgctccct ctgcctctgc aacggctcca gcagtatgag aatctcgtcg tagctttggc tgaaaacaca ggtcccaaca gccctgacca tcaacagctc acacgggctg cccgactgat aagtgagact gcccagagag tccatactat tggtcagaaa cagaagaatg accagcacct tcggcgtgtc caggctctgc tcagtggacg ccaggcaaag gggctgacct cagggcgctg gttcctacgc cagggctggc tgttagtggt gcctccccat ggggagcctc ggccccgcat gttcttcctc ttcactgatg tgctcctcat ggccaagcct cggcctccac tgcacctgct gcggagtggc acctttgcct gcaaggccct ctaccccatg gcccagtgtc atctcagcag ggtctttggc cactcaggag gcccttgtgg tgggttgctc agtctgtcct tccctcatga gaagctactg cttatgtcca cagaccagga ggagctgtca cgctggtacc acagtctgac ttgggctatc agcagccaga aaaactag. It is sometimes possible for the material contained within the vial of "C9orf100, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
