PM20D1 cdna clone
PM20D1 cDNA Clone
Gene Names
PM20D1; Cps1
Synonyms
PM20D1; PM20D1 cDNA Clone; PM20D1 cdna clone
Sequence
atggctcagcggtgcgtttgcgtgctggccctggtggctatgctgctcctagttttccctaccgtctccagatcgatgggcccgaggagcggggagcatcaaagggcgtcgcgaatcccttctcagttcagcaaagaggaacgcgtcgcgatgaaagaggcgctgaaaggtgccatccagattccaacagtgacttttagctctgagaagtccaatactacagccctggctgagttcggaaaatacattcataaagtctttcctacagtggtcagcaccagctttatccagcatgaagtcgtggaagagtatagccacctgttcactatccaaggctcggaccccagcttgcagccctacctgctgatggctcactttgatgtggtgcctgcccctgaagaaggctgggaggtgcccccattctctgggttggagcgtgatggcgtcatctatggttggggcacactggacgacaagaactctgtgatggcattactgcaggccttggagctcctgctgatcaggaagtacatcccccgaagatctttcttcatttctctgggccatgatgaggagtcatcagggacaggggctcagaggatctcagccctgctacagtcaaggggcgtccagctagccttcattgtggacgaggggggcttcatcttggatgatttcattcctaacttcaagaagcccatcgccttgattgcagtctcagagaagggttccatgaacctcatgctgcaagtaaacatgacttcaggccactcttcagctcctccaaaggagacaagcattggcatccttgcagctgctgtcagccgattggagcagacaccaatgcctatcatatttggaagcgggacagtggtgactgtattgcagcaactggcaaatgagtttcccttccctgtcaatataatcctgagcaacccatggctatttgaaccacttataagcaggtttatggagagaaatcccttaaccaatgcaataatcaggaccaccacggcactcaccatattcaaagcaggggtcaagttcaatgtcatccccccagtggcccaggccacagtcaacttccggattcaccctggacagacagtccaagaggtcctagaactcacgaagaacattgtggctgataacagagtccagttccatgtgttgagtgcctttgaccccctccccgtcagcccttctgatgacaaggccttgggctaccagctgctccgccagaccgtacagtccgtcttcccggaagtcaatattactgccccagttacttctattggcaacacagacagccgattctttacaaacctcaccactggcatctacaggttctaccccatctacatacagcctgaagacttcaaacgcatccatggagtcaacgagaaaatctcagtccaagcctatgagacccaagtgaaattcatctttgagttgattcagaatgctgacacagaccaggagccagtttctcacctgcacaaactgtga
Sequence Length
1509
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,544 Da
NCBI Official Full Name
Homo sapiens peptidase M20 domain containing 1, mRNA
NCBI Official Synonym Full Names
peptidase M20 domain containing 1
NCBI Official Symbol
PM20D1
NCBI Official Synonym Symbols
Cps1
NCBI Protein Information
probable carboxypeptidase PM20D1
UniProt Protein Name
Probable carboxypeptidase PM20D1
Protein Family
UniProt Gene Name
PM20D1
UniProt Entry Name
P20D1_HUMAN
Uniprot Description
PM20D1: Belongs to the peptidase M20A family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Secreted; EC 3.4.17.-; Protease; Secreted, signal peptide
Chromosomal Location of Human Ortholog: 1q32.1
Molecular Function: zinc ion binding
Biological Process: peptide catabolic process; regulation of defense response to virus by host; regulation of viral reproduction
Similar Products
Product Notes
The PM20D1 pm20d1 (Catalog #AAA1272058) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcagc ggtgcgtttg cgtgctggcc ctggtggcta tgctgctcct agttttccct accgtctcca gatcgatggg cccgaggagc ggggagcatc aaagggcgtc gcgaatccct tctcagttca gcaaagagga acgcgtcgcg atgaaagagg cgctgaaagg tgccatccag attccaacag tgacttttag ctctgagaag tccaatacta cagccctggc tgagttcgga aaatacattc ataaagtctt tcctacagtg gtcagcacca gctttatcca gcatgaagtc gtggaagagt atagccacct gttcactatc caaggctcgg accccagctt gcagccctac ctgctgatgg ctcactttga tgtggtgcct gcccctgaag aaggctggga ggtgccccca ttctctgggt tggagcgtga tggcgtcatc tatggttggg gcacactgga cgacaagaac tctgtgatgg cattactgca ggccttggag ctcctgctga tcaggaagta catcccccga agatctttct tcatttctct gggccatgat gaggagtcat cagggacagg ggctcagagg atctcagccc tgctacagtc aaggggcgtc cagctagcct tcattgtgga cgaggggggc ttcatcttgg atgatttcat tcctaacttc aagaagccca tcgccttgat tgcagtctca gagaagggtt ccatgaacct catgctgcaa gtaaacatga cttcaggcca ctcttcagct cctccaaagg agacaagcat tggcatcctt gcagctgctg tcagccgatt ggagcagaca ccaatgccta tcatatttgg aagcgggaca gtggtgactg tattgcagca actggcaaat gagtttccct tccctgtcaa tataatcctg agcaacccat ggctatttga accacttata agcaggttta tggagagaaa tcccttaacc aatgcaataa tcaggaccac cacggcactc accatattca aagcaggggt caagttcaat gtcatccccc cagtggccca ggccacagtc aacttccgga ttcaccctgg acagacagtc caagaggtcc tagaactcac gaagaacatt gtggctgata acagagtcca gttccatgtg ttgagtgcct ttgaccccct ccccgtcagc ccttctgatg acaaggcctt gggctaccag ctgctccgcc agaccgtaca gtccgtcttc ccggaagtca atattactgc cccagttact tctattggca acacagacag ccgattcttt acaaacctca ccactggcat ctacaggttc taccccatct acatacagcc tgaagacttc aaacgcatcc atggagtcaa cgagaaaatc tcagtccaag cctatgagac ccaagtgaaa ttcatctttg agttgattca gaatgctgac acagaccagg agccagtttc tcacctgcac aaactgtga. It is sometimes possible for the material contained within the vial of "PM20D1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
