Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLEC14A cdna clone

CLEC14A cDNA Clone

Gene Names
CLEC14A; CEG1; EGFR-5; C14orf27
Synonyms
CLEC14A; CLEC14A cDNA Clone; CLEC14A cdna clone
Ordering
For Research Use Only!
Sequence
atgaagcggcaggcggccgaggaggcctgcatcctgcgaggtggggcgctcagcaccgtgcgtgcgggcgccgagctgcgcgctgtgctcgcgctcctgcgggcaggcccagggcccggagggggctccaaagacctgctgttctgggtcgcactggagcgcaggcgttcccactgcaccctggagaacgagcctttgcggggtttctcctggctgtcctccgaccccggcggtctcgaaagcgacacgctgcagtgggtggaggagccccaacgctcctgcaccgcgcggagatgcgcggtactccaggccaccggtggggtcgagcccgcaggctggaaggagatgcgatgccacctgcgcgccaacggctacctgtgcaagtaccagtttgaggtcttgtgtcctgcgccgcgccccggggccgcctctaacttgagctatcgcgcgcccttccagctgcacagcgccgctctggacttcagtccacctgggaccgaggtgagtgcgctctgccggggacagctcccgatctcagttacttgcatcgcggacgaaatcggcgctcgctgggacaaactctcgggcgatgtgttgtgtccctgccccgggaggtacctccgtgctggcaaatgcgcagagctccctaactgcctagacgacttgggaggctttgcctgcgaatgtgctacgggcttcgagctggggaaggacggccgctcttgtgtgaccagtggggaaggacagccgacccttggggggaccggggtgcccaccaggcgcccgccggccactgcaaccagccccgtgccgcagagaacatggccaatcagggtcgacgagaagctgggagagacaccacttgtccctgaacaagacaattcagtaacatctattcctgagattcctcgatggggatcacagagcacgatgtctacccttcaaatgtcccttcaagccgagtcaaaggccactatcaccccatcagggagcgtgatttccaagtttaattctacgacttcctctgccactcctcaggctttcgactcctcctctgccgtggtcttcatatttgtgagcacagcagtagtagtgttggtgatcttgaccatgacagtactggggcttgtcaagctctgctttcacgaaagcccctcttcccagccaaggaaggagtctatgggcccgccgggcctggagagtgatcctgagcccgctgctttgggctccagttctgcacattgcacaaacaatggggtgaaagtcggggactgtgatctgcgggacagagcagagggtgccttgctggcggagtcccctcttggctctagtgatgcatag
Sequence Length
1341
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,636 Da
NCBI Official Full Name
Homo sapiens C-type lectin domain family 14, member A, mRNA
NCBI Official Synonym Full Names
C-type lectin domain family 14 member A
NCBI Official Symbol
CLEC14A
NCBI Official Synonym Symbols
CEG1; EGFR-5; C14orf27
NCBI Protein Information
C-type lectin domain family 14 member A
UniProt Protein Name
C-type lectin domain family 14 member A
UniProt Gene Name
CLEC14A
UniProt Synonym Gene Names
C14orf27; EGFR5; EGFR-5
UniProt Entry Name
CLC14_HUMAN

NCBI Description

This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This family member plays a role in cell-cell adhesion and angiogenesis. It functions in filopodia formation, cell migration and tube formation. Due to its presence at higher levels in tumor endothelium than in normal tissue endothelium, it is considered to be a candidate for tumor vascular targeting. [provided by RefSeq, Jan 2012]

Uniprot Description

CLEC14A:

Protein type: Protease; Membrane protein, integral

Chromosomal Location of Human Ortholog: 14q21.1

Cellular Component: extracellular matrix

Research Articles on CLEC14A

Similar Products

Product Notes

The CLEC14A clec14a (Catalog #AAA1272045) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcggc aggcggccga ggaggcctgc atcctgcgag gtggggcgct cagcaccgtg cgtgcgggcg ccgagctgcg cgctgtgctc gcgctcctgc gggcaggccc agggcccgga gggggctcca aagacctgct gttctgggtc gcactggagc gcaggcgttc ccactgcacc ctggagaacg agcctttgcg gggtttctcc tggctgtcct ccgaccccgg cggtctcgaa agcgacacgc tgcagtgggt ggaggagccc caacgctcct gcaccgcgcg gagatgcgcg gtactccagg ccaccggtgg ggtcgagccc gcaggctgga aggagatgcg atgccacctg cgcgccaacg gctacctgtg caagtaccag tttgaggtct tgtgtcctgc gccgcgcccc ggggccgcct ctaacttgag ctatcgcgcg cccttccagc tgcacagcgc cgctctggac ttcagtccac ctgggaccga ggtgagtgcg ctctgccggg gacagctccc gatctcagtt acttgcatcg cggacgaaat cggcgctcgc tgggacaaac tctcgggcga tgtgttgtgt ccctgccccg ggaggtacct ccgtgctggc aaatgcgcag agctccctaa ctgcctagac gacttgggag gctttgcctg cgaatgtgct acgggcttcg agctggggaa ggacggccgc tcttgtgtga ccagtgggga aggacagccg acccttgggg ggaccggggt gcccaccagg cgcccgccgg ccactgcaac cagccccgtg ccgcagagaa catggccaat cagggtcgac gagaagctgg gagagacacc acttgtccct gaacaagaca attcagtaac atctattcct gagattcctc gatggggatc acagagcacg atgtctaccc ttcaaatgtc ccttcaagcc gagtcaaagg ccactatcac cccatcaggg agcgtgattt ccaagtttaa ttctacgact tcctctgcca ctcctcaggc tttcgactcc tcctctgccg tggtcttcat atttgtgagc acagcagtag tagtgttggt gatcttgacc atgacagtac tggggcttgt caagctctgc tttcacgaaa gcccctcttc ccagccaagg aaggagtcta tgggcccgcc gggcctggag agtgatcctg agcccgctgc tttgggctcc agttctgcac attgcacaaa caatggggtg aaagtcgggg actgtgatct gcgggacaga gcagagggtg ccttgctggc ggagtcccct cttggctcta gtgatgcata g. It is sometimes possible for the material contained within the vial of "CLEC14A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.