Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP1R2 cdna clone

PPP1R2 cDNA Clone

Gene Names
PPP1R2; IPP2; IPP-2
Synonyms
PPP1R2; PPP1R2 cDNA Clone; PPP1R2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcctcgacggcctcgcaccggcccatcaaggggatcttgaagaacaagacctctacgacttcctctatggtggcgtcggccgaacagccccgcgggaatgtcgacgaggagctgagcaaaaaatcccagaagtgggatgaaatgaacatcttggcgacgtatcatccagcagacaaagactatggtttaatgaaaatagatgaaccaagcactccttaccatagtatgatgggggatgatgaagatgcctgtagtgacaccgaggccactgaagccatggcgccagacatcttagccaggaaattagctgcagctgaaggcttggagccaaagtatcggattcaggaacaagaaagcagtggagaggaggatagtgacctctcacctgaagaacgagaaaaaaagcgacaatttgaaatgaaaaggaagcttcactacaatgaaggactcaatatcaaactagccagacaattaatttcaaaagacctacatgatgatgatgaagatgaagaaatgttagagactgcagatggagaaagcatgaatacggaagaatcaaatcaaggatctactccaagtgaccaacagcaaaacaaattacgaagttcatag
Sequence Length
618
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,015 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 2, mRNA
NCBI Official Synonym Full Names
protein phosphatase 1 regulatory inhibitor subunit 2
NCBI Official Symbol
PPP1R2
NCBI Official Synonym Symbols
IPP2; IPP-2
NCBI Protein Information
protein phosphatase inhibitor 2
UniProt Protein Name
Protein phosphatase inhibitor 2
UniProt Gene Name
PPP1R2
UniProt Synonym Gene Names
IPP2; IPP-2
UniProt Entry Name
IPP2_HUMAN

NCBI Description

Protein phosphatase-1 (PP1) is one of the main eukaryotic serine/threonine phosphatases. The protein encoded by this gene binds to the catalytic subunit of PP1, strongly inhibiting its activity. Ten related pseudogenes have been found throughout the human genome. Several splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

Uniprot Description

PPP1R2: a member of the protein phosphatase inhibitor 1 family. A dopamine- and cyclic AMP-regulated neuronal phosphoprotein. Both dopaminergic and glutamatergic (NMDA) receptor stimulation regulate the extent of DARPP32 phosphorylation, but in opposite directions. Dopamine D1 receptor stimulation enhances cAMP formation, resulting in the phosphorylation of DARPP32; phosphorylated DARPP32 is a potent protein phosphatase-1 inhibitor. NMDA receptor stimulation elevates intracellular calcium, which leads to activation of calcineurin and dephosphorylation of phospho-DARPP32, thereby reducing the phosphatase-1 inhibitory activity of DARPP32. Two alternatively-spliced isoforms have been described.

Protein type: Motility/polarity/chemotaxis; Inhibitor; Protein phosphatase, regulatory subunit

Chromosomal Location of Human Ortholog: 3q29

Cellular Component: protein phosphatase type 1 complex

Molecular Function: protein binding; type 1 serine/threonine specific protein phosphatase inhibitor activity

Biological Process: generation of precursor metabolites and energy; regulation of phosphoprotein phosphatase activity

Research Articles on PPP1R2

Similar Products

Product Notes

The PPP1R2 ppp1r2 (Catalog #AAA1272028) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcct cgacggcctc gcaccggccc atcaagggga tcttgaagaa caagacctct acgacttcct ctatggtggc gtcggccgaa cagccccgcg ggaatgtcga cgaggagctg agcaaaaaat cccagaagtg ggatgaaatg aacatcttgg cgacgtatca tccagcagac aaagactatg gtttaatgaa aatagatgaa ccaagcactc cttaccatag tatgatgggg gatgatgaag atgcctgtag tgacaccgag gccactgaag ccatggcgcc agacatctta gccaggaaat tagctgcagc tgaaggcttg gagccaaagt atcggattca ggaacaagaa agcagtggag aggaggatag tgacctctca cctgaagaac gagaaaaaaa gcgacaattt gaaatgaaaa ggaagcttca ctacaatgaa ggactcaata tcaaactagc cagacaatta atttcaaaag acctacatga tgatgatgaa gatgaagaaa tgttagagac tgcagatgga gaaagcatga atacggaaga atcaaatcaa ggatctactc caagtgacca acagcaaaac aaattacgaa gttcatag. It is sometimes possible for the material contained within the vial of "PPP1R2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.