DNAJC5B cdna clone
DNAJC5B cDNA Clone
Gene Names
DNAJC5B; CSP-beta
Synonyms
DNAJC5B; DNAJC5B cDNA Clone; DNAJC5B cdna clone
Sequence
atggcatgtaacatacctaaccaaagacagcggactctgtcaacaacaggagaagctctatacgaaattcttggtctgcataagggagcatcaaatgaagaaattaagaaaacctacagaaaattggccctgaaacaccatccagacaagaatccagatgatccagctgctactgagaagtttaaagaaatcaacaacgcccacgcaatacttaccgacatttcaaagagaagcatatacgacaagtacggatcgctgggactctacgtggccgagcagtttggagacgaaaacgttaacacctacttcatgctgtcgagctggtgggcaaaggccctgtttgtcatcgttggcctcttgacgggctgctacttttgctgctgcctgtgctgctgctgcaactgctgctgtggacactgccggcccgagtcatcagtgccagaagaggacttctatgtgtccccagaggatctggaggagcagatcaagtctgacatggaaaaagatgtggactttccagtttttctccagcctacaaatgcaaatgagaaaacacagctaatcaaagaaggatctcgaagttattgcacagactcttga
Sequence Length
600
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
22,496 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 5 beta, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member C5 beta
NCBI Official Symbol
DNAJC5B
NCBI Official Synonym Symbols
CSP-beta
NCBI Protein Information
dnaJ homolog subfamily C member 5B
UniProt Protein Name
DnaJ homolog subfamily C member 5B
Protein Family
UniProt Gene Name
DNAJC5B
UniProt Synonym Gene Names
CSP-beta
UniProt Entry Name
DNJ5B_HUMAN
Uniprot Description
DNAJC5B: Interacts with the chaperone complex consisting of HSC70 and SGTA.
Protein type: Chaperone
Chromosomal Location of Human Ortholog: 8q13.1
Molecular Function: protein binding
Research Articles on DNAJC5B
Similar Products
Product Notes
The DNAJC5B dnajc5b (Catalog #AAA1271969) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatgta acatacctaa ccaaagacag cggactctgt caacaacagg agaagctcta tacgaaattc ttggtctgca taagggagca tcaaatgaag aaattaagaa aacctacaga aaattggccc tgaaacacca tccagacaag aatccagatg atccagctgc tactgagaag tttaaagaaa tcaacaacgc ccacgcaata cttaccgaca tttcaaagag aagcatatac gacaagtacg gatcgctggg actctacgtg gccgagcagt ttggagacga aaacgttaac acctacttca tgctgtcgag ctggtgggca aaggccctgt ttgtcatcgt tggcctcttg acgggctgct acttttgctg ctgcctgtgc tgctgctgca actgctgctg tggacactgc cggcccgagt catcagtgcc agaagaggac ttctatgtgt ccccagagga tctggaggag cagatcaagt ctgacatgga aaaagatgtg gactttccag tttttctcca gcctacaaat gcaaatgaga aaacacagct aatcaaagaa ggatctcgaa gttattgcac agactcttga. It is sometimes possible for the material contained within the vial of "DNAJC5B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
