Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EDA cdna clone

EDA cDNA Clone

Gene Names
EDA; ED1; HED; EDA1; EDA2; HED1; ODT1; XHED; ECTD1; XLHED; ED1-A1; ED1-A2; EDA-A1; EDA-A2; TNLG7C; STHAGX1
Synonyms
EDA; EDA cDNA Clone; EDA cdna clone
Ordering
For Research Use Only!
Sequence
atgggctacccggaggtggagcgcagggaactcctgcctgcagcagcgccgcgggagcgagggagccagggctgcgggtgtggcggggcccctgcccgggcgggcgaagggaacagctgcctgctcttcctgggtttctttggcctctcgctggccctccacctgctgacgttgtgctgctacctagagttgcgctcggagttgcggcgggaacgtggagccgagtcccgccttggcggctcgggcacccctggcacctctggcaccctaagcagcctcggtggcctcgaccctgacagccccatcaccagtcaccttgggcagccgtcacctaagcagcagccattggaaccgggagaagccgcactccactctgactcccaggacgggcaccagatggccctattgaatttcttcttccctgatgaaaagccatactctgaagaagaaagtaggcgtgttcgccgcaataaaagaagcaaaagcaatgaaggagcagatggcccagttaaaaacaagaaaaagggaaagaaagcaggacctcctggacccaatggccctccaggacccccaggacctccaggaccccagggacccccaggaattccagggattcctggaattccaggaacaactgttatgggaccacctggtcctccaggtcctcctggtcctcaaggaccccctggcctccagggaccttctggtgctgctgataaagctggaactcgagaaaaccagccagctgtggtgcatctacagggccaagggtcagcaattcaagtcaagaatgatctttcaggtggagtgctcaatgactggtctcgcatcactatgaaccccaaggtgtttaagctacatccccgcagcggggagctggaggtactggtggacggcacctacttcatctatagtcaggtagaagtatactacatcaacttcactgactttgccagctatgaggtggtggtggatgagaagcccttcctgcagtgcacacgcagcatcgagacgggcaagaccaactacaacacttgctataccgcaggcgtctgcctcctcaaggcccggcagaagatcgccgtcaagatggtgcacgctgacatctccatcaacatgagcaagcacaccacgttctttggggccatcaggctgggtgaagcccctgcatcctag
Sequence Length
1176
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,750 Da
NCBI Official Full Name
Homo sapiens ectodysplasin A, mRNA
NCBI Official Synonym Full Names
ectodysplasin A
NCBI Official Symbol
EDA
NCBI Official Synonym Symbols
ED1; HED; EDA1; EDA2; HED1; ODT1; XHED; ECTD1; XLHED; ED1-A1; ED1-A2; EDA-A1; EDA-A2; TNLG7C; STHAGX1
NCBI Protein Information
ectodysplasin-A
UniProt Protein Name
Ectodysplasin-A
Protein Family
UniProt Gene Name
EDA
UniProt Synonym Gene Names
ED1; EDA2; EDA protein
UniProt Entry Name
EDA_HUMAN

NCBI Description

The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

EDA: Seems to be involved in epithelial-mesenchymal signaling during morphogenesis of ectodermal organs. Isoform 1 binds only to the receptor EDAR, while isoform 3 binds exclusively to the receptor XEDAR. Defects in EDA are the cause of ectodermal dysplasia type 1 (ED1); also known as Christ-Siemens-Touraine syndrome or X-linked hypohidrotic ectodermal dysplasia (XLHED). Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. ED1 is a disease characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands. ED1 is the most common form of over 150 clinically distinct ectodermal dysplasias. Defects in EDA are the cause of tooth agenesis selective X-linked type 1 (STHAGX1). A form of selective tooth agenesis, a common anomaly characterized by the congenital absence of one or more teeth. Selective tooth agenesis without associated systemic disorders has sometimes been divided into 2 types: oligodontia, defined as agenesis of 6 or more permanent teeth, and hypodontia, defined as agenesis of less than 6 teeth. The number in both cases does not include absence of third molars (wisdom teeth). Belongs to the tumor necrosis factor family. 8 isoforms of the human protein are produced by alternative splicing.

Protein type: Receptor, misc.; Motility/polarity/chemotaxis; Membrane protein, integral

Chromosomal Location of Human Ortholog: Xq12-q13.1

Cellular Component: cytoskeleton; integral to membrane; intracellular membrane-bound organelle; membrane; plasma membrane

Molecular Function: protein binding; receptor binding

Biological Process: activation of NF-kappaB transcription factor; odontogenesis of dentine-containing teeth; tumor necrosis factor-mediated signaling pathway

Disease: Ectodermal Dysplasia 1, Hypohidrotic, X-linked; Tooth Agenesis, Selective, X-linked, 1

Research Articles on EDA

Similar Products

Product Notes

The EDA eda (Catalog #AAA1271894) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctacc cggaggtgga gcgcagggaa ctcctgcctg cagcagcgcc gcgggagcga gggagccagg gctgcgggtg tggcggggcc cctgcccggg cgggcgaagg gaacagctgc ctgctcttcc tgggtttctt tggcctctcg ctggccctcc acctgctgac gttgtgctgc tacctagagt tgcgctcgga gttgcggcgg gaacgtggag ccgagtcccg ccttggcggc tcgggcaccc ctggcacctc tggcacccta agcagcctcg gtggcctcga ccctgacagc cccatcacca gtcaccttgg gcagccgtca cctaagcagc agccattgga accgggagaa gccgcactcc actctgactc ccaggacggg caccagatgg ccctattgaa tttcttcttc cctgatgaaa agccatactc tgaagaagaa agtaggcgtg ttcgccgcaa taaaagaagc aaaagcaatg aaggagcaga tggcccagtt aaaaacaaga aaaagggaaa gaaagcagga cctcctggac ccaatggccc tccaggaccc ccaggacctc caggacccca gggaccccca ggaattccag ggattcctgg aattccagga acaactgtta tgggaccacc tggtcctcca ggtcctcctg gtcctcaagg accccctggc ctccagggac cttctggtgc tgctgataaa gctggaactc gagaaaacca gccagctgtg gtgcatctac agggccaagg gtcagcaatt caagtcaaga atgatctttc aggtggagtg ctcaatgact ggtctcgcat cactatgaac cccaaggtgt ttaagctaca tccccgcagc ggggagctgg aggtactggt ggacggcacc tacttcatct atagtcaggt agaagtatac tacatcaact tcactgactt tgccagctat gaggtggtgg tggatgagaa gcccttcctg cagtgcacac gcagcatcga gacgggcaag accaactaca acacttgcta taccgcaggc gtctgcctcc tcaaggcccg gcagaagatc gccgtcaaga tggtgcacgc tgacatctcc atcaacatga gcaagcacac cacgttcttt ggggccatca ggctgggtga agcccctgca tcctag. It is sometimes possible for the material contained within the vial of "EDA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.