Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ITGA4 cdna clone

ITGA4 cDNA Clone

Gene Names
ITGA4; IA4; CD49D
Synonyms
ITGA4; ITGA4 cDNA Clone; ITGA4 cdna clone
Ordering
For Research Use Only!
Sequence
atggacaatctaaagcacagcagagtgactgtagcaatacctttaaaatatgaggttaagctgactgttcatgggtttgtaaacccaacttcatttgtgtatggatcaaatgatgaaaatgagcctgaaacgtgcatggtggagaaaatgaacttaactttccatgttatcaacactggcaatagtatggctcccaatgttagtgtggaaataatggtaccaaattcttttagcccccaaactgataagctgttcaacattttggatgtccagactactactggagaatgccactttgaaaattatcaaagagtgtgtgcattagagcagcaaaagagtgcaatgcagaccttgaaaggcatagtccagttcttgtccaagactgataagaggctattgtactgcataaaagctgatccacattgtttaaatttcttgtgtaattttgggaaaatggaaagtggaaaagaagccagtgttcatatccaactggaaggccggccatccattttagaaatggatgagacttcagcactcaagtttgaaataagagcaacaggttttccagagccaaatccaagagtaattgaactaaacaaggatgagaatgttgcgcatgttctactggaaggactacatcatcaaagacccaaacgttatttcaccatagtgattatttcaagtagcttgctacttggacttattgtacttctgttgatctcatatgttatgtggaaggctggcttctttaaaagacaatacaaatctatcctacaagaagaaaacagaagagacagttggagttatatcaacagtaaaagcaatgatgattaa
Sequence Length
834
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,536 Da
NCBI Official Full Name
Homo sapiens integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor), mRNA
NCBI Official Synonym Full Names
integrin subunit alpha 4
NCBI Official Symbol
ITGA4
NCBI Official Synonym Symbols
IA4; CD49D
NCBI Protein Information
integrin alpha-4
UniProt Protein Name
Integrin alpha-4
Protein Family
UniProt Gene Name
ITGA4
UniProt Synonym Gene Names
CD49D
UniProt Entry Name
ITA4_HUMAN

NCBI Description

The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 4 subunit. This subunit associates with a beta 1 or beta 7 subunit to form an integrin that may play a role in cell motility and migration. This integrin is a therapeutic target for the treatment of multiple sclerosis, Crohn's disease and inflammatory bowel disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]

Uniprot Description

ITGA4: Integrins alpha-4/beta-1 (VLA-4) and alpha-4/beta-7 are receptors for fibronectin. They recognize one or more domains within the alternatively spliced CS-1 and CS-5 regions of fibronectin. They are also receptors for VCAM1. Integrin alpha- 4/beta-1 recognizes the sequence Q-I-D-S in VCAM1. Integrin alpha- 4/beta-7 is also a receptor for MADCAM1. It recognizes the sequence L-D-T in MADCAM1. On activated endothelial cells integrin VLA-4 triggers homotypic aggregation for most VLA-4-positive leukocyte cell lines. It may also participate in cytolytic T-cell interactions with target cells. Heterodimer of an alpha and a beta subunit. The alpha subunit can sometimes be cleaved into two non-covalently associated fragments. Alpha-4 associates with either beta-1 or beta-7. Alpha-4 interacts with PXN, LPXN, and TGFB1I1/HIC5. Interacts with CSPG4 through CSPG4 chondroitin sulfate glycosaminoglycan. Belongs to the integrin alpha chain family.

Protein type: Membrane protein, integral; Receptor, misc.; Motility/polarity/chemotaxis; Cell adhesion

Chromosomal Location of Human Ortholog: 2q31.3

Cellular Component: cell surface; focal adhesion; membrane; plasma membrane

Molecular Function: C-X3-C chemokine binding; cell adhesion molecule binding; coreceptor activity; protein binding

Biological Process: B cell differentiation; cell-matrix adhesion; extracellular matrix organization and biogenesis; heterotypic cell-cell adhesion; leukocyte adhesion; leukocyte migration; leukocyte tethering or rolling; receptor clustering; regulation of immune response

Research Articles on ITGA4

Similar Products

Product Notes

The ITGA4 itga4 (Catalog #AAA1271889) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaatc taaagcacag cagagtgact gtagcaatac ctttaaaata tgaggttaag ctgactgttc atgggtttgt aaacccaact tcatttgtgt atggatcaaa tgatgaaaat gagcctgaaa cgtgcatggt ggagaaaatg aacttaactt tccatgttat caacactggc aatagtatgg ctcccaatgt tagtgtggaa ataatggtac caaattcttt tagcccccaa actgataagc tgttcaacat tttggatgtc cagactacta ctggagaatg ccactttgaa aattatcaaa gagtgtgtgc attagagcag caaaagagtg caatgcagac cttgaaaggc atagtccagt tcttgtccaa gactgataag aggctattgt actgcataaa agctgatcca cattgtttaa atttcttgtg taattttggg aaaatggaaa gtggaaaaga agccagtgtt catatccaac tggaaggccg gccatccatt ttagaaatgg atgagacttc agcactcaag tttgaaataa gagcaacagg ttttccagag ccaaatccaa gagtaattga actaaacaag gatgagaatg ttgcgcatgt tctactggaa ggactacatc atcaaagacc caaacgttat ttcaccatag tgattatttc aagtagcttg ctacttggac ttattgtact tctgttgatc tcatatgtta tgtggaaggc tggcttcttt aaaagacaat acaaatctat cctacaagaa gaaaacagaa gagacagttg gagttatatc aacagtaaaa gcaatgatga ttaa. It is sometimes possible for the material contained within the vial of "ITGA4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.