Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLIC4 cdna clone

CLIC4 cDNA Clone

Gene Names
CLIC4; H1; huH1; p64H1; CLIC4L; MTCLIC
Synonyms
CLIC4; CLIC4 cDNA Clone; CLIC4 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgttgtcgatgccgctgaatgggctgaaggaggaggacaaagagcccctcatcgagctcttcgtcaaggctggcagtgatggtgaaagcataggaaactgccccttttcccagaggctcttcatgattctttggctcaaaggagttgtatttagtgtgacgactgttgacctgaaaaggaagccagcagacctgcagaacttggctcccgggacccacccaccatttataactttcaacagtgaagtcaaaacggatgtaaataagattgaggaatttcttgaagaagtcttatgccctcccaagtacttaaagctttcaccaaaacacccagaatcaaatactgctggaatggacatctttgccaaattctctgcatatatcaagaattcaaggccagaggctaatgaagcactggagaggggtctcctgaaaaccctgcagaaactggatgaatatctgaattctcctctccctgatgaaattgatgaaaatagtatggaggacataaagttttctacacgtaaatttctggatggcaatgaaatgacattagctgattgcaacctgctgcccaaactgcatattgtcaaggtggtggccaaaaaatatcgcaactttgatattccaaaagaaatgactggcatctggagatacctaactaatgcatacagtagggacgagttcaccaatacctgtcccagtgataaggaggttgaaatagcatatagtgatgtagccaaaagactcaccaagtaa
Sequence Length
762
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,772 Da
NCBI Official Full Name
Homo sapiens chloride intracellular channel 4, mRNA
NCBI Official Synonym Full Names
chloride intracellular channel 4
NCBI Official Symbol
CLIC4
NCBI Official Synonym Symbols
H1; huH1; p64H1; CLIC4L; MTCLIC
NCBI Protein Information
chloride intracellular channel protein 4
UniProt Protein Name
Chloride intracellular channel protein 4
UniProt Gene Name
CLIC4
UniProt Entry Name
CLIC4_HUMAN

NCBI Description

Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 4 (CLIC4) protein, encoded by the CLIC4 gene, is a member of the p64 family; the gene is expressed in many tissues and exhibits a intracellular vesicular pattern in Panc-1 cells (pancreatic cancer cells). [provided by RefSeq, Jul 2008]

Uniprot Description

CLIC4: Can insert into membranes and form poorly selective ion channels that may also transport chloride ions. Channel activity depends on the pH. Membrane insertion seems to be redox-regulated and may occur only under oxydizing conditions. Promotes cell- surface expression of HRH3. Has alternate cellular functions like a potential role in angiogenesis or in maintaining apical- basolateral membrane polarity during mitosis and cytokinesis. Could also promote endothelial cell proliferation and regulate endothelial morphogenesis (tubulogenesis). Belongs to the chloride channel CLIC family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p36.11

Cellular Component: actin cytoskeleton; apical part of cell; cell surface; centrosome; cytoplasm; cytosol; intercellular junction; intracellular; microtubule cytoskeleton; microvillus; midbody; mitochondrion; nuclear matrix; perinuclear region of cytoplasm; plasma membrane

Molecular Function: glutathione transferase activity; protein binding

Biological Process: angiogenesis; cell differentiation; glutathione metabolic process; keratinocyte differentiation; negative regulation of cell migration

Research Articles on CLIC4

Similar Products

Product Notes

The CLIC4 clic4 (Catalog #AAA1271823) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgttgt cgatgccgct gaatgggctg aaggaggagg acaaagagcc cctcatcgag ctcttcgtca aggctggcag tgatggtgaa agcataggaa actgcccctt ttcccagagg ctcttcatga ttctttggct caaaggagtt gtatttagtg tgacgactgt tgacctgaaa aggaagccag cagacctgca gaacttggct cccgggaccc acccaccatt tataactttc aacagtgaag tcaaaacgga tgtaaataag attgaggaat ttcttgaaga agtcttatgc cctcccaagt acttaaagct ttcaccaaaa cacccagaat caaatactgc tggaatggac atctttgcca aattctctgc atatatcaag aattcaaggc cagaggctaa tgaagcactg gagaggggtc tcctgaaaac cctgcagaaa ctggatgaat atctgaattc tcctctccct gatgaaattg atgaaaatag tatggaggac ataaagtttt ctacacgtaa atttctggat ggcaatgaaa tgacattagc tgattgcaac ctgctgccca aactgcatat tgtcaaggtg gtggccaaaa aatatcgcaa ctttgatatt ccaaaagaaa tgactggcat ctggagatac ctaactaatg catacagtag ggacgagttc accaatacct gtcccagtga taaggaggtt gaaatagcat atagtgatgt agccaaaaga ctcaccaagt aa. It is sometimes possible for the material contained within the vial of "CLIC4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.