Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC39A1 cdna clone

SLC39A1 cDNA Clone

Gene Names
SLC39A1; ZIP1; ZIRTL
Synonyms
SLC39A1; SLC39A1 cDNA Clone; SLC39A1 cdna clone
Ordering
For Research Use Only!
Sequence
atggggccctggggagagccagagctcctggtgtggcgccccgagtcggtagcttcagagcctccagtgcctgtggggctggaggtgaagttgggggccctggtgctgctgctggtgctcaccctcctctgcagcctggtgcccatctgtgtgctgcgccggccaggagctaaccatgaaggctcagcttcccgccagaaagccctgagcctagtaagctgtttcgcggggggcgtctttttggccacttgtctcctggacctgctgcctgactacctggctgccatagatgaggccctggcagccttgcacgtgacgctccagttcccactgcaagagttcatcctggccatgggcttcttcctggtcctggtgatggagcagatcacactggcttacaaggagcagtcagggccgtcacctctggaggaaacaagggctctgctgggaacagtgaatggtgggccgcagcattggcatgatgggccaggggtcccacaggcgagtggagccccagcaaccccctcagccttgcgtgcctgtgtactggtgttctccctggccctccactccgtgttcgaggggctggcggtagggctgcagcgagaccgggctcgggccatggagctgtgcctggctttgctgctccacaagggcatcctggctgtcagcctgtccctgcggctgttgcagagccaccttagggcacaggtggtggctggctgtgggatcctcttctcatgcatgacacctctaggcatcgggctgggtgcagctctggcagagtcggcaggacctctgcaccagctggcccagtctgtgctagagggcatggcagctggcacctttctctatatcacctttctggaaatcctgccccaggagctggccagttctgagcaaaggatcctcaaggtcattctgctcctagcaggctttgccctgctcactggcctgctcttcatccaaatctag
Sequence Length
975
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,589 Da
NCBI Official Full Name
Homo sapiens solute carrier family 39 (zinc transporter), member 1, mRNA
NCBI Official Synonym Full Names
solute carrier family 39 member 1
NCBI Official Symbol
SLC39A1
NCBI Official Synonym Symbols
ZIP1; ZIRTL
NCBI Protein Information
zinc transporter ZIP1
UniProt Protein Name
Zinc transporter ZIP1
Protein Family
UniProt Gene Name
SLC39A1
UniProt Synonym Gene Names
IRT1; ZIP1; ZIRTL; ZIP-1; hZIP1
UniProt Entry Name
S39A1_HUMAN

NCBI Description

This gene encodes a member of the zinc-iron permease family. The encoded protein is localized to the cell membrane and acts as a zinc uptake transporter. This gene has been linked to prostate cancer, breast cancer, and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

Uniprot Description

SLC39A1: Mediates zinc uptake. May function as a major endogenous zinc uptake transporter in many cells of the body. Responsible for the rapid uptake and accumulation of physiologically effective zinc in prostate cells. Belongs to the ZIP transporter (TC 2.A.5) family.

Protein type: Transporter; Membrane protein, integral; Membrane protein, multi-pass; Transporter, SLC family

Chromosomal Location of Human Ortholog: 1q21

Cellular Component: membrane; plasma membrane

Molecular Function: inorganic cation transmembrane transporter activity; zinc ion transmembrane transporter activity

Biological Process: cation transport

Research Articles on SLC39A1

Similar Products

Product Notes

The SLC39A1 slc39a1 (Catalog #AAA1271786) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggccct ggggagagcc agagctcctg gtgtggcgcc ccgagtcggt agcttcagag cctccagtgc ctgtggggct ggaggtgaag ttgggggccc tggtgctgct gctggtgctc accctcctct gcagcctggt gcccatctgt gtgctgcgcc ggccaggagc taaccatgaa ggctcagctt cccgccagaa agccctgagc ctagtaagct gtttcgcggg gggcgtcttt ttggccactt gtctcctgga cctgctgcct gactacctgg ctgccataga tgaggccctg gcagccttgc acgtgacgct ccagttccca ctgcaagagt tcatcctggc catgggcttc ttcctggtcc tggtgatgga gcagatcaca ctggcttaca aggagcagtc agggccgtca cctctggagg aaacaagggc tctgctggga acagtgaatg gtgggccgca gcattggcat gatgggccag gggtcccaca ggcgagtgga gccccagcaa ccccctcagc cttgcgtgcc tgtgtactgg tgttctccct ggccctccac tccgtgttcg aggggctggc ggtagggctg cagcgagacc gggctcgggc catggagctg tgcctggctt tgctgctcca caagggcatc ctggctgtca gcctgtccct gcggctgttg cagagccacc ttagggcaca ggtggtggct ggctgtggga tcctcttctc atgcatgaca cctctaggca tcgggctggg tgcagctctg gcagagtcgg caggacctct gcaccagctg gcccagtctg tgctagaggg catggcagct ggcacctttc tctatatcac ctttctggaa atcctgcccc aggagctggc cagttctgag caaaggatcc tcaaggtcat tctgctccta gcaggctttg ccctgctcac tggcctgctc ttcatccaaa tctag. It is sometimes possible for the material contained within the vial of "SLC39A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.