Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLHL18 cdna clone

KLHL18 cDNA Clone

Synonyms
KLHL18; KLHL18 cDNA Clone; KLHL18 cdna clone
Ordering
For Research Use Only!
Sequence
atgtttacaaatgacatgatggagtgcaagcaggatgagattgtaatgcaaggaatggacccaagtgccctggaggctctgatcaactttgcctacaacggcaaccttgccattgaccagcaaaatgtccagtcattgctgatgggggcgagcttcctgcagctgcagagcatcaaagacgcctgctgcacattccttcgagaacggcttcacccaaaaaactgcctgggtgtgcgccagtttgctgagacaatgatgtgtgctgtgctgtacgacgctgccaacagcttcatccaccagcactttgtggaggtgtccatgtcagaagagttcctggccctgcccttggaagacgtgcttgagctggtgtctcgggatgagctgaatgtcaaatctgaggagcaggtctttgaagctgcattggcctgggtcagatacgaccgggagcagaggggtccctacctgcctgagctgctgtccaatatccgcctgcccctctgtcggccccagttcctttcagacagagtacagcaggatgacctggtgcgttgctgccacaaatgcagggacctggtagacgaagcaaaggactaccacctcatgccagagcgccggccccacctgccagctttcagaacccggccacgctgctgcacatccatcgctggacttatctacgctgtagggggcctcaactcagcaggtgattccctgaatgtggtggaagtgttcgaccccattgccaattgctgggagagatgccgtcccatgacaacagcccgcagccgcgttggcgtggctgtggtgaacgggcttctctatgccatcggaggatatgacggccagctacggctgagcactgtggaggcctacaacccggagacagacacatggaccagagtggggagcatgaatagcaagagaagtgccatggggacagtcgtgctggatgggcagatctacgtctgtgggggctacgatggcaactcttccctcagctccgtggagacctactcacctgagacggacaaatggacagtggtgacctcgatgagctcgaatcgcagtgctgctggggttacagtctttgagggcaggatatatgtgtcaggcggccatgatggtttgcagatcttcagcagtgtggaacactacaaccaccacacagccacctggcaccctgcagctggcatgctcaacaagcgctgccggcacggagccgcctccctggggagcaagatgtttgtctgcgggggctacgatggctctggcttcctcagcattgccgagatgtacagctctgtggcagaccagtggtgcctgattgtccccatgcacacgcgcaggagccgggtctccctggtggccagctgtgggcgcctctacgctgttgggggctacgacggacagtcaaacctaagctcagtggagatgtatgacccagagacagactgctggacattcatggcccccatggcgtgccatgagggaggggtcggtgtgggctgcatccctctcctcaccatctaa
Sequence Length
1530
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,357 Da
NCBI Official Full Name
Homo sapiens kelch-like 18 (Drosophila), mRNA
NCBI Official Synonym Full Names
kelch like family member 18
NCBI Official Symbol
KLHL18
NCBI Protein Information
kelch-like protein 18
UniProt Protein Name
Kelch-like protein 18
Protein Family
UniProt Gene Name
KLHL18
UniProt Synonym Gene Names
KIAA0795
UniProt Entry Name
KLH18_HUMAN

Uniprot Description

KLHL18: 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 3p21.31

Molecular Function: protein binding; ubiquitin-protein ligase activity

Similar Products

Product Notes

The KLHL18 klhl18 (Catalog #AAA1271753) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttacaa atgacatgat ggagtgcaag caggatgaga ttgtaatgca aggaatggac ccaagtgccc tggaggctct gatcaacttt gcctacaacg gcaaccttgc cattgaccag caaaatgtcc agtcattgct gatgggggcg agcttcctgc agctgcagag catcaaagac gcctgctgca cattccttcg agaacggctt cacccaaaaa actgcctggg tgtgcgccag tttgctgaga caatgatgtg tgctgtgctg tacgacgctg ccaacagctt catccaccag cactttgtgg aggtgtccat gtcagaagag ttcctggccc tgcccttgga agacgtgctt gagctggtgt ctcgggatga gctgaatgtc aaatctgagg agcaggtctt tgaagctgca ttggcctggg tcagatacga ccgggagcag aggggtccct acctgcctga gctgctgtcc aatatccgcc tgcccctctg tcggccccag ttcctttcag acagagtaca gcaggatgac ctggtgcgtt gctgccacaa atgcagggac ctggtagacg aagcaaagga ctaccacctc atgccagagc gccggcccca cctgccagct ttcagaaccc ggccacgctg ctgcacatcc atcgctggac ttatctacgc tgtagggggc ctcaactcag caggtgattc cctgaatgtg gtggaagtgt tcgaccccat tgccaattgc tgggagagat gccgtcccat gacaacagcc cgcagccgcg ttggcgtggc tgtggtgaac gggcttctct atgccatcgg aggatatgac ggccagctac ggctgagcac tgtggaggcc tacaacccgg agacagacac atggaccaga gtggggagca tgaatagcaa gagaagtgcc atggggacag tcgtgctgga tgggcagatc tacgtctgtg ggggctacga tggcaactct tccctcagct ccgtggagac ctactcacct gagacggaca aatggacagt ggtgacctcg atgagctcga atcgcagtgc tgctggggtt acagtctttg agggcaggat atatgtgtca ggcggccatg atggtttgca gatcttcagc agtgtggaac actacaacca ccacacagcc acctggcacc ctgcagctgg catgctcaac aagcgctgcc ggcacggagc cgcctccctg gggagcaaga tgtttgtctg cgggggctac gatggctctg gcttcctcag cattgccgag atgtacagct ctgtggcaga ccagtggtgc ctgattgtcc ccatgcacac gcgcaggagc cgggtctccc tggtggccag ctgtgggcgc ctctacgctg ttgggggcta cgacggacag tcaaacctaa gctcagtgga gatgtatgac ccagagacag actgctggac attcatggcc cccatggcgt gccatgaggg aggggtcggt gtgggctgca tccctctcct caccatctaa. It is sometimes possible for the material contained within the vial of "KLHL18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.