Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TAZ cdna clone

TAZ cDNA Clone

Gene Names
TAZ; EFE; BTHS; EFE2; G4.5; Taz1; CMD3A; LVNCX
Synonyms
TAZ; TAZ cDNA Clone; TAZ cdna clone
Ordering
For Research Use Only!
Sequence
atgcctctgcacgtgaagtggccgttccccgcggtgccgccgctcacctggaccctggccagcagcgtcgtcatgggcttggtgggcacctacagctgcttctggaccagtgagtgggcccaggccgaggcaggcccgcccgggtacccatgcccggccggagggatcctgaaactccgccacatctggaacctgaagttgatgcgttggacccctgcagctgcagacatctgcttcaccaaggagctacactcccacttcttcagcttgggcaagtgtgtgcctgtgtgccgaggagatggcgtctaccagaaggggatggacttcattttggagaagctcaaccatggggactgggtgcatatcttcccagaaggaatcgggcgcctgattgctgagtgtcatctcaaccccatcatcctgcccctgtggcatgtcggtgagcctggggacggggacagagagatggcatctggggtggggggcctgggactccctctggtcccaggctgccctgctccaccccacgtctggccttctgtccactgtgctgcaggaatgaatgacgtccttcctaacagtccgccctacttcccccgctttggacagaaaatcactgtgctgatcgggaagcccttcagtgccctgcctgtactcgagcggctccgggcggagaacaagtcggctgtggagatgcggaaagccctgacggacttcattcaagaggaattccagcatctgaagactcaggcagagcagctccacaaccacctccagcctgggagatag
Sequence Length
789
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,836 Da
NCBI Official Full Name
Homo sapiens tafazzin, mRNA
NCBI Official Synonym Full Names
tafazzin
NCBI Official Symbol
TAZ
NCBI Official Synonym Symbols
EFE; BTHS; EFE2; G4.5; Taz1; CMD3A; LVNCX
NCBI Protein Information
tafazzin
UniProt Protein Name
Tafazzin
Protein Family
UniProt Gene Name
TAZ
UniProt Synonym Gene Names
EFE2; G4.5
UniProt Entry Name
TAZ_HUMAN

NCBI Description

This gene encodes a protein that is expressed at high levels in cardiac and skeletal muscle. Mutations in this gene have been associated with a number of clinical disorders including Barth syndrome, dilated cardiomyopathy (DCM), hypertrophic DCM, endocardial fibroelastosis, and left ventricular noncompaction (LVNC). Multiple transcript variants encoding different isoforms have been described. A long form and a short form of each of these isoforms is produced; the short form lacks a hydrophobic leader sequence and may exist as a cytoplasmic protein rather than being membrane-bound. Other alternatively spliced transcripts have been described but the full-length nature of all these transcripts is not known. [provided by RefSeq, Jul 2008]

Uniprot Description

tafazzin: Some isoforms may be involved in cardiolipin (CL) metabolism. Defects in TAZ are the cause of Barth syndrome (BTHS). An X-linked disease characterized by dilated cardiomyopathy with endocardial fibroelastosis, a predominantly proximal skeletal myopathy, growth retardation, neutropenia, and organic aciduria, particularly excess of 3-methylglutaconic acid. Additional features include hypertrophic cardiomyopathy, isolated left ventricular non-compaction, ventricular arrhythmia, motor delay, poor appetite, fatigue and exercise intolerance, hypoglycemia, lactic acidosis, hyperammonemia, and dramatic late catch-up growth after growth delay throughout childhood. Belongs to the taffazin family. 9 isoforms of the human protein are produced by alternative splicing.

Protein type: Mitochondrial; Membrane protein, integral; Transferase

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: intrinsic to membrane; mitochondrial inner membrane; mitochondrial membrane; mitochondrion

Molecular Function: 1-acylglycerol-3-phosphate O-acyltransferase activity; 1-acylglycerophosphocholine O-acyltransferase activity; O-acyltransferase activity

Biological Process: cardiac muscle contraction; cardiac muscle development; cardiolipin biosynthetic process; cristae formation; heart development; hemopoiesis; mitochondrial respiratory chain complex I assembly; muscle contraction; organelle ATP synthesis coupled electron transport; skeletal muscle development

Disease: Barth Syndrome

Research Articles on TAZ

Similar Products

Product Notes

The TAZ taz (Catalog #AAA1271728) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctctgc acgtgaagtg gccgttcccc gcggtgccgc cgctcacctg gaccctggcc agcagcgtcg tcatgggctt ggtgggcacc tacagctgct tctggaccag tgagtgggcc caggccgagg caggcccgcc cgggtaccca tgcccggccg gagggatcct gaaactccgc cacatctgga acctgaagtt gatgcgttgg acccctgcag ctgcagacat ctgcttcacc aaggagctac actcccactt cttcagcttg ggcaagtgtg tgcctgtgtg ccgaggagat ggcgtctacc agaaggggat ggacttcatt ttggagaagc tcaaccatgg ggactgggtg catatcttcc cagaaggaat cgggcgcctg attgctgagt gtcatctcaa ccccatcatc ctgcccctgt ggcatgtcgg tgagcctggg gacggggaca gagagatggc atctggggtg gggggcctgg gactccctct ggtcccaggc tgccctgctc caccccacgt ctggccttct gtccactgtg ctgcaggaat gaatgacgtc cttcctaaca gtccgcccta cttcccccgc tttggacaga aaatcactgt gctgatcggg aagcccttca gtgccctgcc tgtactcgag cggctccggg cggagaacaa gtcggctgtg gagatgcgga aagccctgac ggacttcatt caagaggaat tccagcatct gaagactcag gcagagcagc tccacaacca cctccagcct gggagatag. It is sometimes possible for the material contained within the vial of "TAZ, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.