Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC38A5 cdna clone

SLC38A5 cDNA Clone

Gene Names
SLC38A5; SN2; JM24; SNAT5; pp7194
Synonyms
SLC38A5; SLC38A5 cDNA Clone; SLC38A5 cdna clone
Ordering
For Research Use Only!
Sequence
atggaactgcaggatccaaagatgaatggagccctcccttcggatgctgtgggctacaggcaagaacgtgagggcttcctgcccagtcgtggtcctgctcctgggagcaagccggtccagttcatggatttcgaggggaagacatcgtttggaatgtcagtgttcaacctcagcaacgccatcatgggcagcggcatcctggggctggcctatgccatggcccacacgggggtcatcttcttcctggccctgctgctgtgcattgcgcttctgtcgtcctactccatccacctcctgctgacctgtgctggtattgcaggcatccgagcctatgagcagctgggacagagggcattcgggcctgcggggaaggtagtggtggccacagtcatctgtctgcacaatgttggggccatgtccagttacctgttcatcatcaaatctgagctccccctggttatcggcaccttcctgtacatggaccccgagggggactggttcttgaagggaaacctcctcatcatcatcgtcagtgtgttaatcatcctgcccctcgccctcatgaaacacttgggctacctggggtacaccagtggtctctctctgacctgcatgctgtttttccttgtttcggtcatctacaagaagttccaacttggctgtgctataggccacaatgaaacagcaatggagagtgaagctctcgtgggactccccagccaaggactcaacagcagctgtgaggcccagatgttcacagttgactcacagatgtcctacacagtgcccattatggcttttgcttttgtctgccaccctgaggtgctgcccatctatacggagctctgccggccctccaagcgcaggatgcaggccgtggccaacgtgtccattggggccatgttctgcatgtatgggctcacagcaacctttggatacctcaccttctacagcagtgtgaaggcggagatgctgcacatgtacagccagaaggacccgctcatcctctgtgtgcgcctggccgtgctgctcgcggtgaccctcactgtgccagtcgtgctgttccctatccgccgggccctgcagcagctgcttttcccaggcaaggccttcagctggccacgacatgtggccatagctctgatcctgcttgttttggtcaatgtccttgtcatctgtgtgccaaccatccgggatatctttggagttatcgggtccacctcagcccccagcctcatcttcatcctccccagcatcttctacctccgcattgtaccctctgaggtggagcctttcttatcctggcccaagatccaggccctgtgctttggagtcctgggagtcctcttcatggccgtcagtctaggctttatgtttgccaactgggccacaggccagagccgcatgtctggacactga
Sequence Length
1419
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,916 Da
NCBI Official Full Name
Homo sapiens solute carrier family 38, member 5, mRNA
NCBI Official Synonym Full Names
solute carrier family 38 member 5
NCBI Official Symbol
SLC38A5
NCBI Official Synonym Symbols
SN2; JM24; SNAT5; pp7194
NCBI Protein Information
sodium-coupled neutral amino acid transporter 5
UniProt Protein Name
Sodium-coupled neutral amino acid transporter 5
UniProt Gene Name
SLC38A5
UniProt Synonym Gene Names
JM24; SN2; SNAT5
UniProt Entry Name
S38A5_HUMAN

NCBI Description

The protein encoded by this gene is a system N sodium-coupled amino acid transporter. The encoded protein transports glutamine, asparagine, histidine, serine, alanine, and glycine across the cell membrane, but does not transport charged amino acids, imino acids, or N-alkylated amino acids. Alternative splicing results in multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Aug 2013]

Uniprot Description

SLC38A5: Functions as a sodium-dependent amino acid transporter which countertransport protons. Mediates the saturable, pH- sensitive, and electrogenic cotransport of several neutral amino acids including glycine, asparagine, alanine, serine, glutamine and histidine with sodium. Belongs to the amino acid/polyamine transporter 2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter; Transporter, SLC family; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: Xp11.23

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: amino acid transmembrane transporter activity; glycine transmembrane transporter activity

Biological Process: amino acid transport

Research Articles on SLC38A5

Similar Products

Product Notes

The SLC38A5 slc38a5 (Catalog #AAA1271725) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaactgc aggatccaaa gatgaatgga gccctccctt cggatgctgt gggctacagg caagaacgtg agggcttcct gcccagtcgt ggtcctgctc ctgggagcaa gccggtccag ttcatggatt tcgaggggaa gacatcgttt ggaatgtcag tgttcaacct cagcaacgcc atcatgggca gcggcatcct ggggctggcc tatgccatgg cccacacggg ggtcatcttc ttcctggccc tgctgctgtg cattgcgctt ctgtcgtcct actccatcca cctcctgctg acctgtgctg gtattgcagg catccgagcc tatgagcagc tgggacagag ggcattcggg cctgcgggga aggtagtggt ggccacagtc atctgtctgc acaatgttgg ggccatgtcc agttacctgt tcatcatcaa atctgagctc cccctggtta tcggcacctt cctgtacatg gaccccgagg gggactggtt cttgaaggga aacctcctca tcatcatcgt cagtgtgtta atcatcctgc ccctcgccct catgaaacac ttgggctacc tggggtacac cagtggtctc tctctgacct gcatgctgtt tttccttgtt tcggtcatct acaagaagtt ccaacttggc tgtgctatag gccacaatga aacagcaatg gagagtgaag ctctcgtggg actccccagc caaggactca acagcagctg tgaggcccag atgttcacag ttgactcaca gatgtcctac acagtgccca ttatggcttt tgcttttgtc tgccaccctg aggtgctgcc catctatacg gagctctgcc ggccctccaa gcgcaggatg caggccgtgg ccaacgtgtc cattggggcc atgttctgca tgtatgggct cacagcaacc tttggatacc tcaccttcta cagcagtgtg aaggcggaga tgctgcacat gtacagccag aaggacccgc tcatcctctg tgtgcgcctg gccgtgctgc tcgcggtgac cctcactgtg ccagtcgtgc tgttccctat ccgccgggcc ctgcagcagc tgcttttccc aggcaaggcc ttcagctggc cacgacatgt ggccatagct ctgatcctgc ttgttttggt caatgtcctt gtcatctgtg tgccaaccat ccgggatatc tttggagtta tcgggtccac ctcagccccc agcctcatct tcatcctccc cagcatcttc tacctccgca ttgtaccctc tgaggtggag cctttcttat cctggcccaa gatccaggcc ctgtgctttg gagtcctggg agtcctcttc atggccgtca gtctaggctt tatgtttgcc aactgggcca caggccagag ccgcatgtct ggacactga. It is sometimes possible for the material contained within the vial of "SLC38A5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.