CNIH4 cdna clone
CNIH4 cDNA Clone
Gene Names
CNIH4; CNIH-4; HSPC163
Synonyms
CNIH4; CNIH4 cDNA Clone; CNIH4 cdna clone
Sequence
atggaggcggtggtgttcgtcttctctctcctcgattgttgcgcgctcatcttcctctcggtctacttcataattacattgtctgatttagaatgtgattacattaatgctagatcatgttgctcaaaattaaacaagtgggtaattccagaattgattggccataccattgtcactgtattactgctcatgtcattgcactggttcatcttccttctcaacttacctgttgccacttggaatatatatcgatacattatggtgccgagtggtaacatgggagtgtttgatccaacagaaatacacaatcgagggcagctgaagtcacacatgaaagaagccatgatcaagcttggtttccacttgctctgcttcttcatgtatctttatagtatgatcttagctttgataaatgactga
Sequence Length
420
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
10,615 Da
NCBI Official Full Name
Homo sapiens cornichon homolog 4 (Drosophila), mRNA
NCBI Official Synonym Full Names
cornichon family AMPA receptor auxiliary protein 4
NCBI Official Symbol
CNIH4
NCBI Official Synonym Symbols
CNIH-4; HSPC163
NCBI Protein Information
protein cornichon homolog 4
UniProt Protein Name
Protein cornichon homolog 4
UniProt Gene Name
CNIH4
UniProt Synonym Gene Names
CNIH-4
UniProt Entry Name
CNIH4_HUMAN
Uniprot Description
CNIH4: Belongs to the cornichon family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 1q42.11
Cellular Component: endoplasmic reticulum; ER-Golgi intermediate compartment
Molecular Function: CCR5 chemokine receptor binding; protein binding
Biological Process: ER to Golgi vesicle-mediated transport
Similar Products
Product Notes
The CNIH4 cnih4 (Catalog #AAA1271631) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcgg tggtgttcgt cttctctctc ctcgattgtt gcgcgctcat cttcctctcg gtctacttca taattacatt gtctgattta gaatgtgatt acattaatgc tagatcatgt tgctcaaaat taaacaagtg ggtaattcca gaattgattg gccataccat tgtcactgta ttactgctca tgtcattgca ctggttcatc ttccttctca acttacctgt tgccacttgg aatatatatc gatacattat ggtgccgagt ggtaacatgg gagtgtttga tccaacagaa atacacaatc gagggcagct gaagtcacac atgaaagaag ccatgatcaa gcttggtttc cacttgctct gcttcttcat gtatctttat agtatgatct tagctttgat aaatgactga. It is sometimes possible for the material contained within the vial of "CNIH4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
