SH3YL1 cdna clone
SH3YL1 cDNA Clone
Gene Names
SH3YL1; RAY
Synonyms
SH3YL1; SH3YL1 cDNA Clone; SH3YL1 cdna clone
Sequence
atgaataaccctataccttccaatttgaaatcagaagcaaaaaaggctgccaaaatattaagagaattcacagaaataacttccagaaatggacctgataagatcattcctgctcacgtaattgcgaaggctaaaggccttgcaattctgtctgtgatcaaagccgggttcctggtgactgccagaggaggcagcgggattgtagtggcgcgccttccagatggaaaatggtctgcaccctcagccattgggatagctggccttggtggaggatttgaaataggaattgaggtatcagacttggtgataattctgaattatgaccgtgctgtagaagcttttgcaaaaggcggaaatctgaccctcggagggaacttgactgtggcggttgggcccttgggaaggaacttggaaggaaacgtggccctgagaagctccgctgccgtcttcacgtactgcaagtcaaggggactctttgcaggcgtgtctttagaagggagctgtttgattgaaaggaaagaaactaatagaaaattttattgtcaagatatccgagcttatgacattttatttggagatacaccgcggcctgctcaagccgaagatctttatgaaattcttgattcctttactgaaaagtatgaaaatgaaggacaacgaatcaatgcaagaaaagcagcaagggagcagaggaagtcttctgctaaagaattacctccaaagccattgtcaagaccacagcagtcatctgcaccagtccagctgaactctggctctcaaagtaacagaaatgaatataagctctatcctggactttccagctatcatgagagagttggcaatttgaatcaacccatagaagtgacagcgctgtattcatttgaaggacagcagcctggggatttgaattttcaagctggagacagaatcacagttatatcaaaaacagattcacattttgattggtgggaaggaaaacttcgaggtcaaactggcatttttccagccaactacgtaaccatgaattaa
Sequence Length
1029
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
11,809 Da
NCBI Official Full Name
Homo sapiens SH3 domain containing, Ysc84-like 1 (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SH3 and SYLF domain containing 1
NCBI Official Symbol
SH3YL1
NCBI Official Synonym Symbols
RAY
NCBI Protein Information
SH3 domain-containing YSC84-like protein 1
UniProt Protein Name
SH3 domain-containing YSC84-like protein 1
Protein Family
UniProt Gene Name
SH3YL1
UniProt Entry Name
SH3Y1_HUMAN
Uniprot Description
SH3YL1: Belongs to the SH3YL1 family. 5 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 2p25.3
Molecular Function: phosphatase binding; phosphoinositide binding; protein binding
Research Articles on SH3YL1
Similar Products
Product Notes
The SH3YL1 sh3yl1 (Catalog #AAA1271570) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaataacc ctataccttc caatttgaaa tcagaagcaa aaaaggctgc caaaatatta agagaattca cagaaataac ttccagaaat ggacctgata agatcattcc tgctcacgta attgcgaagg ctaaaggcct tgcaattctg tctgtgatca aagccgggtt cctggtgact gccagaggag gcagcgggat tgtagtggcg cgccttccag atggaaaatg gtctgcaccc tcagccattg ggatagctgg ccttggtgga ggatttgaaa taggaattga ggtatcagac ttggtgataa ttctgaatta tgaccgtgct gtagaagctt ttgcaaaagg cggaaatctg accctcggag ggaacttgac tgtggcggtt gggcccttgg gaaggaactt ggaaggaaac gtggccctga gaagctccgc tgccgtcttc acgtactgca agtcaagggg actctttgca ggcgtgtctt tagaagggag ctgtttgatt gaaaggaaag aaactaatag aaaattttat tgtcaagata tccgagctta tgacatttta tttggagata caccgcggcc tgctcaagcc gaagatcttt atgaaattct tgattccttt actgaaaagt atgaaaatga aggacaacga atcaatgcaa gaaaagcagc aagggagcag aggaagtctt ctgctaaaga attacctcca aagccattgt caagaccaca gcagtcatct gcaccagtcc agctgaactc tggctctcaa agtaacagaa atgaatataa gctctatcct ggactttcca gctatcatga gagagttggc aatttgaatc aacccataga agtgacagcg ctgtattcat ttgaaggaca gcagcctggg gatttgaatt ttcaagctgg agacagaatc acagttatat caaaaacaga ttcacatttt gattggtggg aaggaaaact tcgaggtcaa actggcattt ttccagccaa ctacgtaacc atgaattaa. It is sometimes possible for the material contained within the vial of "SH3YL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
